Evidence-Based Complementary and Alternative Medicine / 2012 / Article / Tab 1

Research Article

In Vivo Anti-Influenza Virus Activity of Japanese Herbal (Kampo) Medicine, “Shahakusan,” and Its Possible Mode of Action

Table 1

Primers sequences used for real-time PCR.

GenePrimerLength

GAPDHForward
TGTCCGTCGTGGATCTGAC
75
ReverseCCTGCTTCACCACCTTCTTG
IFN- Forward
TACTGCCACGGCACAGTCATTGAAA
144
ReverseGCTCTGCAGGATTTTCATGTCACCA
IL-1 Forward
TGTTCTTTGAAGTTGACGGACCCCA
108
ReverseTGATGTGCTGCTGCGAGATTTGA
IL-4Forward
CCAGCTAGTTGTCATCCTGCTCTTC
150
ReverseACGTTTGGCACATCCATCTCCG
IL-10Forward
TTTGAATTCCCTGGGTGAGAA
98
ReverseGCTCCACTGCCTTGCTCTTATT
IL-12AForward
CCATCAGCAGATCATTCTAGACAA
146
ReverseGGATGCAGAGCTTCATTTTCA
IL-12BForward
TGAACTGGCGTTGGAAGCACGG
102
ReverseTGCAAGTTCTTGGGCGGGTCTG
IP-10Forward
TGAGGGCCATAGGGAAGCTTGAAAT
109
ReverseTCCGGATTCAGACATCTCTGCTCAT