Research Article

Intestinal Protective Effects of Herbal-Based Formulations in Rats against Neomycin Insult

Table 2

The sequences of the primers employed in qRT-PCR analysis of rat stool bacterial DNA targeting 16S rRNA gene of the universal bacteria or Lactobacillus spp.

Target genePSSequence (5′–3′)OAT References

Universal bacteriaFCCTACGGGAGGCAGCAG60°C [17]
RATTACCGCGGTGCTGG

Lactobacillus spp.FGAGGCAGCAGTAGGGAATCTTC60°C [18]
RGGCCAGTTACTACCTCTATCCTTCTTC

PS: primer sets; F: forward; R: reverse; OAT: optimized annealing temperature.