Evidence-Based Complementary and Alternative Medicine

Evidence-Based Complementary and Alternative Medicine / 2013 / Article
Special Issue

Primo Vascular System: Past, Present, and Future

View this Special Issue

Research Article | Open Access

Volume 2013 |Article ID 205951 | https://doi.org/10.1155/2013/205951

An Ping, Su Zhendong, Dai Jingxing, Liu Yaling, Kyung-Hee Bae, Tan Shiyun, Luo Hesheng, Kwang-Sup Soh, Yeon Hee Ryu, Sungchul Kim, "Discovery of Endothelium and Mesenchymal Properties of Primo Vessels in the Mesentery", Evidence-Based Complementary and Alternative Medicine, vol. 2013, Article ID 205951, 10 pages, 2013. https://doi.org/10.1155/2013/205951

Discovery of Endothelium and Mesenchymal Properties of Primo Vessels in the Mesentery

Academic Editor: M. Isabel Miguel Perez
Received27 Nov 2012
Revised22 Jan 2013
Accepted30 Jan 2013
Published15 Apr 2013


Recent evidences demonstrated that endothelial-to-mesenchymal transition (EndMT) has a crucial role in cancer and is recognized as a unique source of cancer-associated fibroblasts (CAFs). Primo vascular system (PVS) is a new circulatory system which may play an important role in cancer metastasis and regeneration. In the current study, we applied previously established time-saving method to identify primo vessels and further investigated the immunocytochemical properties of primo vessels. Both primo vessels and primary primo vessel cells in the mesentery expressed endothelial markers and fibroblast markers. Double-labeling experiments demonstrated that endothelial and fibroblast markers are coexpressed in primo vessels. In addition, under the stimulation of TGF- 1 in vitro, primary primo vessel cells differentiated into fibroblasts. Therefore, we found that primo vessels in the mesentery had a transitional structure between endothelium and mesenchymal. This is a new finding of EndMT in normal postnatal animals.

1. Introduction

Recently, growing evidence manifested that endothelial cells could be triggered to acquire a mesenchymal phenotype (fibroblast-like cells and loss of cell-cell contacts), obtain mesenchymal biological properties (invasive and migratory capabilities), and gain mesenchymal markers [14]. These studies indicated that there existed a unique population of cells that coexpressed both endothelial marker CD31 (also known as platelet endothelial cell adhesion molecule-1 (PECAM-1)) and fibroblast markers, such as PDI, MTS1 (S100A4, also known as FSP1), and procollagen I. Researchers supposed that these recruit fibroblasts mainly arose from endothelial cells and categorized this process as endothelial-to-mesenchymal transition (EndMT). EndMT was first detected in embryonic heart development and later was observed in a variety of pathologic procedures, including cancer, chronic kidney fibrosis, cardiac fibrosis, chronic pulmonary hypertension, atherosclerosis, and wound healing [413]. Although the function and precise molecular mechanisms of EndMT in some postnatal diseases have not yet been determined, their determinant role in cancer was conclusively established. Now EndMT was recognized as a crucial source of cancer-associated fibroblasts (CAFs) which modulated cancer progression and played a definitive role in cancer metastasis, microenvironment and angiogenesis [4, 12, 1421]. EndMT was a critical process and mechanism contributed to a setting of pathological diseases [5, 11, 22]. Does EndMT also occur in normal postnatal states? Till now, no answer can be found.

Primo Vascular System (PVS) is a new kind of circulatory system beyond vascular and lymphatic system [23]. On International Symposium of Primo Vascular System 2010 (ISPS2010), the functional role of PVS in cancer, especially in tumor metastasis, and regeneration was extensively discussed [24, 25]. In this work, we investigated cellular properties of the PVS in the mesentery with immunocytochemistry by studying the primo vessels and their primary cultured cells with endothelial and mesenchymal antibodies. In previous studies [23], there were much work with DAPI and phalloidin to establish the histological characteristics of PVS which we repeated in this work for searching and identifying the PVS in the mesentery specimens. Because thorough immunocytochemical study with the endothelial antibodies and mesenchymal antibodies to characterize the primo vessel was lacking, the EndMT was not noticed before. Furthermore, no study was ever performed with primary cultured cells of the PVS. By performing this study, we found not only the immunocytochemical properties of endothelial and mesenchymal cells of the PVS in the mesentery but also a novel case of EndMT in a normal postnatal animal.

Our study showed that primo vessels in the mesentery coexpressed endothelial markers (CD31, VE-cadherin, vWF) along with fibroblast markers (PDI, MTS1, procollagen I). Primary primo vessel cells also coexpressed these markers and showed a fibroblast-like phenotype. Further investigation revealed that over 14 days culture in vitro, primo vessel cells differentiated into fibroblasts and showed increased levels of collagen α1(I) mRNA and protein secretion. We deduced primo vessels in the mesentery as a unique structure consisting of EndMT cells. To our knowledge, this might be the first evidence to validate a transitional structure between endothelium and mesenchymal in normal postnatal animals. We believe that this discovery will enrich the recognition and concept of EndMT which maybe exist in normal tissues and conductive to angiogenesis.

2. Materials and Methods

2.1. Animals

Seven-week-old male and female Sprague-Dawley rats, weighing 200–250 g (Jung-Ang Laboratory Animal Company, Seoul, Korea), were used in this study. For each separate experiment, three rats of each gender were used. Animal care, maintenance, and surgery were performed in accordance with the international laws and policies of the Care and Use of Laboratory Animals, National Academy Press (1996).

2.2. Sample Preparation

Rats were anaesthetized with urethane (1.5 g/kg) (Sigma, MO) i.m., and then the abdomens were opened. Under a stereomicroscope (SZX12, Olympus, Japan), primo vessels in the mesentery between the colon and the root of mesentery and between the colon and the small intestine were carefully detected. Primo vessels with a characteristic appearance of semitransparent, white thread-like lines were taken out and were carefully checked under the stereomicroscope to avoid the involvement of vascular vessels and lymphatic vessels. For immunofluorescent study, vascular vessels and lymphatic vessels were chosen as controls. After embedding in OCT (Sakura Finetek, CA), all the tissues were rapidly frozen over liquid nitrogen and stored at −80°C until processed.

2.3. Phalloidin and DAPI Staining in Tissue Samples and Cryosections

To confirm the role of phalloidin combined with 4′,6-diamidino-2-phenylindole (DAPI) staining in distinguishing primo vessels from vascular vessels and lymphatic vessels, we performed phalloidin (Invitrogen, CA) and DAPI (Invitrogen, CA) staining in tissue samples and cryosections at first. The main procedure was as follows. Fresh tissues or 10 μm-thickness cryosections were fixed in 3.7% formaldehyde at room temperature (RT) for 10 min. After being washed with 0.1 M phosphate buffered saline (PBS) three times, the samples were further treated with 0.2% Triton-X100 for 5 min. Then, the tissues were washed in PBS and incubated with Alexa Fluor 568 phalloidin (1 : 50) for 2 h in the dark at room temperature (RT). After PBS washing, DAPI (0.1 mg/mL) was added and incubated for 30 min, and then tissues were mounted with prolong gold antifade reagent (Invitrogen, CA). Staining was analyzed independently by two investigators using a fluorescence microscope (BX51, Olympus, Japan).

2.4. Isolation of Primary Primo Vessel Cells and Cell Culture

Primary primo vessel cells were obtained from 7-week-old SD rats according to the following procedures. Briefly, primo vessels in the mesentery were gently washed three times with PBS, moved into a cell culture dish, and minced with a disposable surgery knife for approximately 2 min. Tissues were incubated in a solution of 1% collagenase type I (Sigma, MO) dissolved in Hank’s balanced salt solution at 37°C for 2 h. Then, the suspension was centrifuged (1200 g for 3 min), and the cells were seeded in a six-well cell culture plate at the desired density (2.5 to 5 × 105 cells per well) and cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco by Invitrogen, CA) supplemented with 10% fatal bovine serum (FBS, Gibco by Invitrogen, CA), 100 U/mL of penicillin (Gibco by Invitrogen, CA), and 100 μg/mL of streptomycin sulfate (Gibco by Invitrogen, CA) at 37°C in a 5% CO2 incubation. After 30 min of incubation, suspension cells were removed, and adherent primo vessel cells were cultured in the above medium. Cell cultures were observed by phase contrast microscopy to verify growth, and viability was routinely checked by a trypan blue exclusion assay (Sigma, MO). Cultures showing viability over 95% were used. Culture medium was replaced every 3 d.

The murine fibroblast NIH3T3 cell line and the rat fibroblast BHK-21 cell line were chosen as controls in this study. They were obtained from SNU cell bank (Seoul, Korea) and were cultured in DMEM supplemented with 10% FBS, 100 U/mL of penicillin, and 100 μg/mL of streptomycin sulfate.

2.5. Immunohistochemistry and Phalloidin Staining

Tissue samples were cut into 10 μm longitudinal cryosections for immunofluorescence staining. In single staining, sections of primo vessels were rinsed in PBS and fixed in 4% PFA at 4°C for 10 min. After washing (3 × 10 min in PBS), fixed sections were permeabilized with 0.1% Triton X-100 in PBS for 15 min. Nonspecific binding was blocked by incubation with serum solution for 2 h at room temperature. Then, sections were incubated with primary antibodies overnight at 4°C at the following dilutions: monoclonal anti-CD31 antibody (mouse anti-rat) at 1 : 200, polyclonal anti-vWF antibody (rabbit anti-rat) at 1 : 200, monoclonal anti-PDI antibody (mouse anti-rat) at 1 : 400, polyclonal anti-FSP1 antibody (rabbit anti-rat) at 1 : 200, polyclonal anti-VE-cadherin antibody (rabbit anti-rat) at 1 : 200, polyclonal anti-procollagen I antibody (rabbit anti-rat) at 1 : 400, and polyclonal rabbit anti-LYVE-1 (rabbit anti-rat) at 1 : 200 (Santa Cruz Biotechnology, CA). To detect immunofluorescence, sections were washed and incubated with Alexa Fluor 488- (1 : 400) or 594- (1 : 400), (Invitrogen, CA) for 2 h in the dark at RT. After washing in PBS, sections were incubated with Alexa Fluor 488 phalloidin or Alexa Fluor 568 phalloidin (1 : 50) for 2 h. Counterstaining was performed with DAPI, and the glass coverslips were mounted on the slides with prolong gold antifade reagent. As negative controls, the primary antibody was replaced with nonimmune IgG. Staining was analyzed independently by two investigators using a fluorescence microscope and further processed with Adobe Photoshop CS5 extended computer software.

2.6. Immunocytochemistry

For cell immunofluorescent staining, cells were washed in PBS for three times and fixed with pure Acetone for 20 min at −20°C. Then, cells were blocked with serum solution and incubated with the primary antibodies overnight at 4°C. After rinsed again, immunostaining cells were incubated for 45 min at room temperature with Alexa Fluor 488- and 594-conjugated secondary antibodies and mounted with prolong gold antifade reagent with DAPI.

2.7. Double Immunofluorescent Labeling

For a double immunofluorescence procedure, we incubated the sections and cells with two primary antibodies at 4°C overnight. We blocked samples with 10% donkey serum for 2 h at room temperature. The primary antibodies were anti-CD31 (1 : 200), anti-vWF (1 : 200), and anti-PDI (1 : 200). After washing in PBS, the sections and cells were incubated in the dark with a mixture of two secondary antibodies as described already.

2.8. Assessment of the Differentiation Capacity of Primo Vessel Cells In Vitro

The differentiation capacity of primo vessel cells was further tested in vitro. After cultured in DMEM with or without 5 ng/mL TGF-β1 (Pierce, Rockford, IL, USA) stimulation for indicated days, endothelial markers (vWF, CD31, VE-cadherin), and fibroblast markers (PDI, MTS1, procollagen I) expression in primo vessel cells were determined by immunocytochemistry. Culture media was refreshed every 3 days.

2.9. mRNA Isolation and Real-Time PCR

Total RNA was extracted from cultured primo vessel cells using the Trizol reagents according to the protocol provided by the manufacturer (Invitrogen, Carlsbad, CA, USA). The RNA content was measured spectrophotometrically. Then, total RNA (2 μg) was treated with DNase I followed by synthesis of the first strand of DNA using reverse transcription system. Real-time PCR was performed in 25 μL of reaction mixture containing 0.4 μM primers, 2 μL of cDNA product, 5 mM dNTPs, 0.75 units of Taq polymerase (Invitrogen, CA, USA), and 1 μL of iQ-SYBR green supermix reagent (Bio-Rad, CA, USA). Fold changes of target gene mRNA levels relative to the endogenous glyceraldehyde-3-phosphate dehydrogenase (GAPDH) control were calculated. The sequences of the primers were listed in Table 1. The mRNA levels were expressed as fold changes after normalization.

PrimerSequences (5′-3′)Size

Rat collagen 1(I) Forward: TTCCCTGGACCTAAGGGTACT113 bp

2.10. ELISA Analysis

For collagen α1(I) secretion in primo vessel cells culture media, it was measured using ELISA method. Primo vessel cells were cultured in six-well plates at a density of 5 × 103 cells/well for indicated days. Then, supernatants were collected, and a sandwich ELISA for collagen α1(I) (Santa Cruz Biotechnology, CA) was performed. Optical densities were measured using an ELISA plate reader at 450 nm. Results are expressed as fold increases of collagen α1(I) secretion compared with cells without TGF-β1 stimulation.

2.11. Statistics

All results were expressed as the means ± SE of at least three independent experiments. A one-way ANOVA was used to evaluate differences between groups ( was considered significant).

3. Results and Discussion

3.1. Identification of Primo Vessels in the Mesentery in Fresh Tissues and Cryosections

Our previous studies have demonstrated that primo vessels located in the mesentery of rats [26]. They had prominent histological features such as rod-shaped nuclei with linear alignments, multiple-sinus, and collagen fibers inside the structures, and sometimes outer membranes were observed. We also found that using phalloidin (specific to F-actin) and DAPI staining, the cells’ shape and arrangements of primo vessels were clearly detected. Here, we applied this method in distinguishing primo vessels from vascular vessels and lymphatic vessels. As shown in Figure 1(a), primo vessel cells had characteristic rod-shaped nuclei with linear arrangements, and their regular arrays along the vessels were clearly detected with phalloidin staining. Vascular smooth muscle cells were also sensitive to phalloidin but showed thoroughly different arrangement from primo vessels (Figure 1(a), arrowheads). As for lymphatic vessels, the endothelial cells were weakly positive to phalloidin and showed as a network structure (Figure 1(a), arrows). On the basis of phalloidin/DAPI double staining in reliably distinguishing primo vessels, vascular vessels, and lymphatic vessels in fresh tissues, we further employed this method in cryosections. As shown in Figure 1(b), in longitudinal cryosections, the structures with rod-shaped nuclei in linear alignments, and positive phalloidin expression (yellow dashed area) were considered as primo vessels. This method established in previous researches [23, 24, 26] was used in the current work as a time-saving method to detect primo vessels not only in tissue samples but also in longitudinal cryosections.

3.2. Endothelial and Fibroblast Markers Expressed in Primo Vessels in the Mesentery

To investigate the biological properties of primo vessels, we first examined their endothelium features. Our results revealed that endothelial markers (vWF, CD31, VE-cadherin) were positive in primo vessels (Figure 2, green) and indicated their endothelium properties. Then, we performed fibroblasts markers (PDI, MTS1, procollagen I) in our experiments. As shown in Figure 2, primo vessels also positively expressed fibroblast markers (green). We concluded that primo vessels in the mesentery also possessed mesenchymal features. In addition, primo vessels negatively expressed a lymphatic endothelial cell marker, LYVE-1. As a control, endothelial markers (vWF, CD31, VE-cadherin) and fibroblast markers (PDI, MTS1, procollagen I) were also tested in vascular vessels (Figure 3). Next, we performed double-labeling experiments with endothelial and fibroblast markers to verify the possible properties of both endothelium and mesenchymal in primo vessels. The colocalization of vWF/PDI and CD31/PDI in primo vessels (Figure 4(a)) demonstrated that primo vessels are a transitional structure between endothelium and mesenchymal.

3.3. Endothelial and Fibroblast Markers Expressed in Primary Primo Vessel Cells

To further demonstrate our observation of endothelial and fibroblast markers in primo vessels, we isolated and cultured primary primo vessel cells in rat mesentery. According to the potential biological features of fibroblasts in primo vessel cells, we performed collagenase digestion method in primary primo vessel cell isolation. Our data showed that on the 3rd and 5th day, primo vessel cells showed fibroblast-like shapes (Figure 5). We stained primo vessel cells with antibodies to endothelial markers (vWF, CD31, VE-cadherin) and fibroblast markers (PDI, MST1, procollagen I) (Figure 6(a)). The results revealed that all these markers positively expressed in primo vessel cells. NIH3T3 cell line and BHK-21 cell line were selected as controls and only positive to fibroblast markers (PDI, MST1, procollagen I) (Figure 6(b)). Double labeling with vWF/PDI and CD31/PDI supported the conception that primo vessel cells were ascribed to a phenotype between endothelial cells and fibroblasts (Figure 7).

3.4. Differentiation of Primo Vessel Cells into Fibroblasts In Vitro

Our results indicated that in the mesentery, primo vessels were a unique transitional structure possessing both endothelial and mesenchymal properties. We deduced that primo vessel cells had differentiation potential. Under different stimulations, they might be induced and perform endothelial cells or fibroblasts functions. To verify this deduction, we studied the plasticity of primo vessel cells in vitro. We found that with the induction of TGF-β1, primo vessel cells transformed into fibroblasts over 5 days. Endothelial markers (vWF, CD31, VE-cadherin) diminished, and just fibroblast markers (PDI, MTS1, procollagen I) were positive in these cells (Figure 8(a)). One of the important functions of fibroblasts is to synthesize and produce extracellular matrix (ECM), especially collagen α1(I) [27, 28]. We found that in contrast to primo vessel cells, both the collagen α1(I) mRNA and protein secretion obviously increased in cells with TGF-β1 stimulation (Figure 8(b)). These data demonstrated that primo vessel cells differentiated into fibroblasts. Primo vessel cells are a new source of fibroblasts.

4. Conclusions

In conclusion, our research demonstrated that primo vessels in the mesentery were a special transitional structure between endothelium and mesenchymal. Primo vessel cells had the capability of differentiation into fibroblasts in vitro. It is a new finding of EndMT in normal postnatal states.


This work was supported in part by a grant from the Traditional Korean Medicine R&D Project, Ministry of Health & Welfare, Republic of Korea (B110076), Department of Acupuncture, Korea Institute of Oriental Medicine, Daejeon, Republic of Korea (K12272), and Natural Science Foundation of Hubei Province, China (2012FKB04432).


  1. J. D. Potts and R. B. Runyan, “Epithelial-mesenchymal cell transformation in the embryonic heart can be mediated, in part, by transforming growth factor β,” Developmental Biology, vol. 134, no. 2, pp. 392–401, 1989. View at: Google Scholar
  2. Y. Nakajima, T. Yamagishi, S. Hokari et al., “Mechanisms involved in valvuloseptal endocardial cushion formation in early cardiogenesis: roles of transforming growth factor (TGF)-beta and bone morphogenetic protein (BMP),” Anatomical Record, vol. 258, pp. 119–127, 2000. View at: Google Scholar
  3. E. J. Armstrong and J. Bischoff, “Heart valve development: endothelial cell signaling and differentiation,” Circulation Research, vol. 95, no. 5, pp. 459–470, 2004. View at: Publisher Site | Google Scholar
  4. H. S. Shin, H. M. Johng, B. C. Lee et al., “Feulgen reaction study of novel threadlike structures (Bonghan ducts) on the surfaces of mammalian organs,” Anatomical Record B, vol. 284, no. 1, pp. 35–40, 2005. View at: Publisher Site | Google Scholar
  5. R. R. Markwald, T. P. Fitzharris, and F. J. Manasek, “Structural development of endocardial cushions,” American Journal of Anatomy, vol. 148, no. 1, pp. 85–119, 1977. View at: Google Scholar
  6. X. Mao, Y. Fujiwara, and S. H. Orkin, “Improved reporter strain for monitoring Cre recombinase-mediated DNA excisions in mice,” Proceedings of the National Academy of Sciences of the United States of America, vol. 96, no. 9, pp. 5037–5042, 1999. View at: Publisher Site | Google Scholar
  7. E. Gustafsson, C. Brakebusch, K. Hietanen, and R. Fässler, “Tie-1-directed expression of Cre recombinase in endothelial cells of embryoid bodies and transgenic mice,” Journal of Cell Science, vol. 114, no. 4, pp. 671–676, 2001. View at: Google Scholar
  8. E. M. Zeisberg, S. E. Potenta, H. Sugimoto, M. Zeisberg, and R. Kalluri, “Fibroblasts in kidney fibrosis emerge via endothelial-to-mesenchymal transition,” Journal of the American Society of Nephrology, vol. 19, no. 12, pp. 2282–2287, 2008. View at: Publisher Site | Google Scholar
  9. E. M. Zeisberg, O. Tarnavski, M. Zeisberg et al., “Endothelial-to-mesenchymal transition contributes to cardiac fibrosis,” Nature Medicine, vol. 13, no. 8, pp. 952–961, 2007. View at: Publisher Site | Google Scholar
  10. E. M. Zeisberg, S. Potenta, L. Xie, M. Zeisberg, and R. Kalluri, “Discovery of endothelial to mesenchymal transition as a source for carcinoma-associated fibroblasts,” Cancer Research, vol. 67, no. 21, pp. 10123–10128, 2007. View at: Publisher Site | Google Scholar
  11. P. Zhu, L. Huang, X. Ge, F. Yan, R. Wu, and Q. Ao, “Transdifferentiation of pulmonary arteriolar endothelial cells into smooth muscle-like cells regulated by myocardin involved in hypoxia-induced pulmonary vascular remodelling,” International Journal of Experimental Pathology, vol. 88, no. 2, pp. 127–128, 2007. View at: Publisher Site | Google Scholar
  12. S. Potenta, E. Zeisberg, and R. Kalluri, “The role of endothelial-to-mesenchymal transition in cancer progression,” British Journal of Cancer, vol. 99, no. 9, pp. 1375–1379, 2008. View at: Publisher Site | Google Scholar
  13. J. G. Lee and E. P. Kay, “FGF-2-mediated signal transduction during endothelial mesenchymal transformation in corneal endothelial cells,” Experimental Eye Research, vol. 83, no. 6, pp. 1309–1316, 2006. View at: Publisher Site | Google Scholar
  14. J. C. Tse and R. Kalluri, “Mechanisms of metastasis: epithelial-to-mesenchymal transition and contribution of tumor microenvironment,” Journal of Cellular Biochemistry, vol. 101, no. 4, pp. 816–829, 2007. View at: Publisher Site | Google Scholar
  15. L. Selek, M. Dhobb, B. Van Der Sanden, F. Berger, and D. Wion, “Existence of tumor-derived endothelial cells suggests an additional role for endothelial-to-mesenchymal transition in tumor progression,” International Journal of Cancer, vol. 128, no. 6, pp. 1502–1503, 2011. View at: Publisher Site | Google Scholar
  16. R. Kalluri and M. Zeisberg, “Fibroblasts in cancer,” Nature Reviews Cancer, vol. 6, no. 5, pp. 392–401, 2006. View at: Publisher Site | Google Scholar
  17. E. Olaso, A. Santisteban, J. Bidaurrazaga, A. M. Gressner, J. Rosenbaum, and F. Vidal-Vanaclocha, “Tumor-dependent activation of rodent hepatic stellate cells during experimental melanoma metastasis,” Hepatology, vol. 26, no. 3, pp. 634–642, 1997. View at: Google Scholar
  18. I. Cornil, D. Theodorescu, S. Man, M. Herlyn, J. Jambrosic, and R. S. Kerbel, “Fibroblast cell interactions with human melanoma cells affect tumor cell growth as a function of tumor progression,” Proceedings of the National Academy of Sciences of the United States of America, vol. 88, no. 14, pp. 6028–6032, 1991. View at: Google Scholar
  19. E. Olaso, C. Salado, E. Egilegor et al., “Proangiogenic role of tumor-activated hepatic stellate cells in experimental melanoma metastasis,” Hepatology, vol. 37, no. 3, pp. 674–685, 2003. View at: Publisher Site | Google Scholar
  20. M. T. Dimanche-Boitrel, L. Vakaet, P. Pujuguet et al., “In vivo and in vitro invasiveness of a rat colon-cancer cell line maintaining E-cadherin expression: an enhancing role of tumor-associated myofibroblasts,” International Journal of Cancer, vol. 56, no. 4, pp. 512–521, 1994. View at: Google Scholar
  21. A. Orimo, P. B. Gupta, D. C. Sgroi et al., “Stromal fibroblasts present in invasive human breast carcinomas promote tumor growth and angiogenesis through elevated SDF-1/CXCL12 secretion,” Cell, vol. 121, no. 3, pp. 335–348, 2005. View at: Publisher Site | Google Scholar
  22. J. P. Thiery, H. Acloque, R. Y. J. Huang, and M. A. Nieto, “Epithelial-mesenchymal transitions in development and disease,” Cell, vol. 139, no. 5, pp. 871–890, 2009. View at: Publisher Site | Google Scholar
  23. K. S. Soh, “Bonghan circulatory system as an extension of acupuncture meridians,” JAMS Journal of Acupuncture and Meridian Studies, vol. 2, no. 2, pp. 93–106, 2009. View at: Publisher Site | Google Scholar
  24. J. S. Yoo, M. Hossein Ayati, H. B. Kim, W. B. Zhang, and K. S. Soh, “Characterization of the primo-vascular system in the abdominal cavity of lung cancer mouse model and its differences from the lymphatic system,” PLoS ONE, vol. 5, no. 4, Article ID e9940, 2010. View at: Publisher Site | Google Scholar
  25. J. S. Yoo, H. B. Kim, N. Won et al., “Evidence for an additional metastatic route: in vivo imaging of cancer cells in the primo-vascular system around tumors and organs,” Molecular Imaging and Biology, vol. 13, no. 3, pp. 471–480, 2011. View at: Publisher Site | Google Scholar
  26. P. An, J. Dai, Z. Su, J. S. Yoo, R. Qu, S. W. Lee et al., “Putative primo-vascular system in mesentery of rats,” Journal of Acupuncture and Meridian Studies, vol. 3, pp. 232–240, 2010. View at: Google Scholar
  27. J. J. Tomasek, G. Gabbiani, B. Hinz, C. Chaponnier, and R. A. Brown, “Myofibroblasts and mechano: regulation of connective tissue remodelling,” Nature Reviews Molecular Cell Biology, vol. 3, no. 5, pp. 349–363, 2002. View at: Publisher Site | Google Scholar
  28. G. Parsonage, A. D. Filer, O. Haworth et al., “A stromal address code defined by fibroblasts,” Trends in Immunology, vol. 26, no. 3, pp. 150–156, 2005. View at: Publisher Site | Google Scholar

Copyright © 2013 An Ping et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

More related articles

 PDF Download Citation Citation
 Download other formatsMore
 Order printed copiesOrder

Related articles

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.