Table 1: List of sequences used for RT-PCR.

GeneSequenceLength (bP)

iNOSForward: ACCTTGGAGTTCACCCAGT
170
Reverse: ACCACTCGTACTTGGGATGC
COX-2Forward: GCGAGCTAAGAGCTTCAGGA
212
Reverse: TCATACATTCCCCACGGTTT
TNF- Forward: CTGGGACAGTGACCTGGACT
204
Reverse: GCACCTCAGGGAAGAGTCTG
IL-6Forward: AGTTGCCTTCTTGGGACTGA
159
Reverse: TCCACGATTTCCCAGAGAAC
18sForward: GTAACCCGTTGAACCCCATT140
Reverse: CCATCCAATCGGTAGTAGCG