Table of Contents Author Guidelines Submit a Manuscript
Evidence-Based Complementary and Alternative Medicine

Volume 2014 (2014), Article ID 712634, 6 pages

http://dx.doi.org/10.1155/2014/712634
Research Article

Antiviral Activity of Sulfated Polysaccharide of Adenanthera pavonina against Poliovirus in HEp-2 Cells

1Departamento de Microbiologia, CCB, UEL, 86051-990 Londrina, PR, Brazil

2Departamento de Química Orgânica e Inorgânica, UFC, 60020-181 Fortaleza, CE, Brazil

Received 5 May 2014; Revised 29 July 2014; Accepted 3 August 2014; Published 20 August 2014

Academic Editor: Jairo Kenupp Bastos

Copyright © 2014 Ananda Marques de Godoi et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Adenanthera pavonina, popularly known as red-bead tree, carolina, pigeon’s eye, and dragon’s eye, is a plant traditionally used in Brazil for the treatment of several diseases. The present study aimed at evaluating the activity of sulfated polysaccharide from the Adenanthera pavonina (SPLSAp) seeds against poliovirus type 1 (PV-1) in HEp-2 cell cultures. The SPLSAp presented a cytotoxic concentration (CC50) of 500 μg/mL in HEp-2 cell cultures, evaluated by the dimethylthiazolyl-diphenyltetrazolium bromide method (MTT). The SPLSAp exhibited a significant antiviral activity, with a 50% inhibitory concentration (IC50) of 1.18 µg/mL, determined by plaque reduction assay and a high selectivity index (SI) of 423. The maximum inhibition (100%) of PV replication was found when the SPLSAp treatment was concomitant with viral infection (time 0 h), at all tested concentrations. The maximal inhibition was also found when the SPLSAp was used 1 h and 2 h postinfection, albeit at 50 μg/mL and 100 μg/mL. Therefore, we demonstrated that the SPLSAp inhibited PV growth. We also suggested that SPLSAp inhibited PV in more than one step of the replication, as the mechanism of antiviral action. We, therefore, selected the compound as a potential candidate for further development towards the control of the infection.

1. Introduction

For many decades, natural products have been regarded as potential antivirals in parallel to their counterpart antibacterial action, mainly on the ground of empirical practice of healing. The reason for the search for these substances has been encouraged, amongst them, for their low toxicity and the possibility of multistep mechanism of action. The latter effect could represent lesser selective pressure for the emergence of resistant virus strains in comparison to single-targeted drugs. Screening of medicinal plants has shown a vast number of phytochemicals, such as alkaloids, anthraquinones, coumarins, flavonoids, polyphenols, tannins, and terpenoids, among others, active against several viruses [1]. In addition, high-molecular-weight compounds, for instance, sulfated polysaccharides from plants, marine algae, cyanobacteria, and animal sources, have been extensively investigated for this purpose [2]. Studies showed the low cytotoxicity and safety of sulfated polysaccharides [2, 3] and their health beneficial effects. Sulfated polysaccharides from marine seaweeds, for example, among several therapeutic applications, are known to inhibit free radical generation [3]. Further advantages of the use of native or sulfated polysaccharides for medicinal purposes are low production costs, safety, wide acceptability, and their biochemical versatility. Brazil has a great potential for research in this area due to its outstanding biodiversity and ethnopharmacological knowledge of many medicinal plants [4]. Adenanthera pavonina (Leguminosae) is a plant popularly known as red-bead tree, carolina, pigeon’s eye, and dragon’s eye [5], common in Brazil and used for reforestation and handicraft and in popular medicine [6, 7]. The seeds, rich in fat and protein, are used as food by Indian tribes [5, 8]. It is used against fever, vomiting, diarrhea, stomach problems, gout, rheumatism, boils, hypertension, pulmonary infections, and chronic ophthalmia, empirically. [8, 9]. Pharmacological effects, such as, antioxidant, anti-inflammatory, analgesic, antihypertensive, anthelmintic, antibacterial, and antifungal effects, have been scientifically demonstrated [10, 11]. Poliovirus (PV) is the etiologic agent of poliomyelitis, a small, nonenveloped positive-stranded RNA virus (genus Enterovirus, Picornaviridae family) [12]. Currently, poliomyelitis is under control in most parts of the world, but, despite intensive efforts to eradicate the virus, the disease remains endemic in some countries in Africa and Asia, with 407 cases reported in 2013 [13]. The disease has a great epidemiological importance and there is an increasing concern of the world health authorities for the permanent risk it still represents, despite the vaccination program. Moreover, PV is one of the best-understood models of virus and much used in tests for new antiviral drugs. Therefore, we choose PV to evaluate the antiviral effect of the SPLSAp in HEp-2 cell cultures.

2. Materials and Methods

2.1. Compound: Adenanthera pavonina (L.)

Seeds were collected at the Campus do Pici, Universidade Federal do Ceará, Fortaleza, CE, Brazil, in November and December 2010. A. pavonina polysaccharide was isolated from the endosperms and extracted with hot water (85°C) [14]. To obtain the sulfated polysaccharide (SPLSAp), 300 mg of galactomannan was allowed to swell in pyridine:N,N-dimethylformamide (50 : 10 v/v) with stirring at 25°C (12 h) until finely dispersed suspensions were obtained. The suspension was cooled to 4°C and 12 mL chlorosulfonic acid was slowly added with stirring over 24 h at 4°C. The resulting solutions were neutralized with saturated aqueous NaHCO3, dialyzed (molecular weight cut off 8–12 kDa) for 120 h against distilled water, and the sulfated derivative was collected after lyophilization [15, 16]. The degree of sulfation (DS) was ascertained from the sulfur content (%S) determined by elemental analysis using a Perkin-Elmer CHNS 2400 analyzer and the calculation provided by equation - [17]. SPLSAp Fourier transform-IR spectrum was recorded with a Shimadzu IR spectrophotometer (8300) in the range of 400 and 4000 cm−1 as a KBr pellet. The molar mass was determined by gel permeation chromatography with a Shimadzu LC-10AD chromatograph with a RID-10A refractive index detector at 40°C. The analysis was performed with an Ultrahydrogel linear column (7.8 mm × 300 mm), flow rate of 0.5 mL/min, and polysaccharide concentration of 0.1% (w/v), dissolved in water, and 0.1 mol/L sodium nitrate was used as eluent. The intrinsic viscosity [η] was determined in a Cannon-Fenske viscometer (Schott-Geräte, AVS-350) with thermostated capillary Schott 520 13 at 25°C ±0.01.

2.2. Cells and Virus

HEp-2 cells (epithelial human larynx carcinoma cells, ATCC CCL-23) were grown at 37°C in Dulbecco’s modified Eagle’s medium (DMEM), supplemented with 10% fetal bovine serum (*Life Technology Corp., USA), and treated with 100 μg/mL streptomycin (*), 100 IU/mL of penicillin (Novafarma Indústria Farmacêutica, BR), and 2.5 μg/mL of amphotericin B (Meizler Biopharma, BR). Poliovirus type-1 (PV-1), ATCC, VR-58, was propagated in HEp-2 cell cultures and stored at −20°C with 10% glycerol. The virus titer was determined by plaque assay.

2.3. Cytotoxicity Assay

The SPLSAp cytotoxicity was determined by MTT kit assay (Sigma Chem. Co., USA), according to the manufacturer’s instructions. Briefly, 70% confluent HEp-2 cell cultures grown in 96-well microplates (Nunc A/S, Denmark) were treated with varying concentrations of the SPLSAp (50 μg/mL to 1000 μg/mL) and maintained at 37°C with 5% CO2 for 72 h. The overlay medium was replaced with 10 μL of the MTT reagent (1.25 μg/mL) and incubated as before, for 3 h. This was followed by the addition of 90 μL of the solubilizer agent and after 15 min the absorbance read at 570 and 690 nm. The percentage of cell viability (%CV) was calculated by the formula %CV = , where At and Ac refer to the absorbance of test substance and control (untreated cells), respectively [18]. The concentration of the SPLSAp capable of reducing cell viability by 50% compared to cell control and calculated by linear regression analysis corresponds to the 50% cytotoxic concentration (CC50).

2.4. Plaque Reduction Assay

The antiviral activity of the SPLSAp was determined by plaque reduction assay (PRA) according to Lopes et al. [19]. HEp-2 cells grown in 24-well plates (TPP, CH) to 100% confluence were infected with PV (50 to 100 PFU) and treated simultaneously with varying concentrations of the SPLSAp (0.78 to 100 μg/mL). These cell cultures were overlaid with nutrient agarose (DMEM 2x/1.8% agarose [v/v]) containing 25 mM MgCl2. After 40-hour incubation, the cells were fixed with 10% formaldehyde in phosphate-buffered saline (PBS), pH 7.3, for 24 hours. Cells were stained with 0.5% crystal violet in 20% ethanol. The plaques were counted and percentage of viral inhibition (%IV) was calculated as , where and refer to the number of plaques in the presence and absence of the compound, respectively [20]. The concentration of the SPLSAp that inhibited 50% PFU (IC50) was calculated by linear regression analysis and the selectivity index (SI) was expressed by the ratio CC50/IC50. Human alfa-2B interferon (Meizler Biopharma S/A, BR) was used as positive control.

2.4.1. Time-of-Addition Assay

It was performed according to Yamamoto et al. [18] in that varying concentrations of the SPLSAp (12.5 μg/mL, 25 μg/mL, 50 μg/mL, 100 μg/mL) were added to the cell cultures simultaneously (0 h) and before (−1 and −2 h) and after (1, 2, 4, and 8 h) the infection, followed by PRA.

2.4.2. Virucidal Effect

A virus suspension was incubated with varying concentrations of the SPLSAp (12.5–100 μg/mL) (v/v) for 1 h at 37°C in water bath, diluted to the tenth and the residual infectivity determined by PRA [21].

2.4.3. Inhibition of Adsorption Assay

The cell monolayers previously maintained at 4°C for 1 hour were infected in the presence of the SPLSAp, at the same concentrations, as before, and kept for further 80 min at 4°C. The cell cultures were washed with cold PBS to remove nonadsorbed virus followed by PRA [22].

2.5. Immunofluorescence Assay (IFA)

HEp-2 cell cultures grown on coverslips, in 24-well plates, were infected with 500 μL of PV and simultaneously treated with varying concentrations of the SPLSAp (12.5 μg/mL, 25 μg/mL, 50 μg/mL, and 100 μg/mL). Cultures of infected and untreated cells and cultures of untreated and noninfected cells were maintained for controls. After 24 h, the cells were washed with 0.05% Tween 20 PBS, fixed with cold acetone (−20°C), and blocked with 2% powdered skim milk PBS. The cells were incubated for 30 min at 37°C with rabbit anti-PV-1 serum (INCQS-Fiocruz, BR), further washed three times with Tween 20 PBS, and incubated for 30 min at 37°C, with sheep anti-rabbit IgG FITC conjugate (Sigma Chem. Co., EUA) [23]. The cells were examined in a Zeiss fluorescence microscope (Zeiss Axio Imager A1). A total of 100 cells/coverslip were randomly chosen and the percentage of fluorescent cells was calculated in comparison to nonfluorescent cells.

2.6. RT-PCR

RNA of cells infected and treated with SPLSAp at 1.56 μg/mL to 25 μg/mL and that of the respective controls (human alpha-2B interferon, virus, and cell controls) were extracted with QIAamp RNA Mini Kit. The first reaction mixture consisting of 5 pmol of random primer, 1 mM dNTP, and RNAse-free water up to 7 mL was prepared. Seven microliters of the first reaction mixture and 5 μL of the extracted viral RNA were incubated for 5 min at 65°C. A second reaction mixture consisting of 1x M-MLV reaction buffer, 0.01 M DTT, 100 U M-MLV (Moloney Murine Leukemia Virus) reverse transcriptase, and RNAse-free water up to 8 μL was prepared. Eight microliters of second reaction mixture was added to each sample and sequentially incubated for 10 min at 25°C, 50 min at 37°C, and 15 min at 70°C. The PCR reaction was carried out at a final volume of 25 μL containing 0.4 mM dNTP, 2 pmol of each primer, 2.5 U Taq DNA polymerase with PCR buffer, and cDNA. Specific primers for PV capsid gene (VP1-VP4) were 5′AGTTTCACCGAAGGCGGA 3′(F) and 5′CGCTGACACAAAACCAAGGA 3′(R), resulting in a 102 bp amplified product. The PCR program consisted of denaturation at 95°C for 10 min, followed by 40 cycles by denaturation for 15 sec at 95°C, annealing at 60°C for 1 min, and extension for 1 min at 72°C. The final cycle of extension was 7 min at 72°C. Ten-microliter aliquots of the PCR products were resolved in 12% polyacrylamide gel electrophoresis [19].

2.7. Statistical Analysis

Anova followed by Tukey’s test (BioEstat 5.0 for Windows XP, 2007) was used to determine the difference among the SPLSAp experiments and control groups. Values of were considered significant.

3. Results

3.1. Characterization of the SPLSAp

The presence of sulfated groups was identified by infrared spectrum and presented 13.6% of amount of S (S%) and degree of sulfation (DS) 1.21. The compound presented an absorption at 1257 cm−1, assigned to the asymmetric stretching vibration of the S=O linkage [24, 25] and showed characteristic absorption bands of the galactomannans, as reported elsewhere [2630]. The η for SPLSAp was 3.2 dL/g and the molar mass was 7.0 × 105 g/mol similar to those reported for sulfated galactomannans for M. scabrella (6.20 × 105 g mol−1) [31] and L. leucocephala (5.74 × 105 g mol−1) [16].

3.2. Anti-PV Activity of the SPLSAp

Table 1 shows theSPLSAp CC50 (500 μg/mL) and its antiviral activity under the assays of the time of addition (0 h), virucidal and inhibition of adsorption, and the respective SI. The most efficient effect is indicated at the time 0 h by the IC50 1.18 μg/mL and the SI 423.73. Figure 1 shows that the maximum inhibitory effect was found at this time period (time 0 h), at all tested concentrations. Times 1 and 2 h postinfection (pi.) also demonstrated high %VI, 95% and 93%, respectively, at 25 μg/mL, and 100% at 50 and 100 μg/mL, at both times. When the SPLSAp was added at 4 and 8 h pi., a slight reduction was observed; however, the inhibition remained above 70% for the two highest concentrations. Lower effect was detected at 1 and 2 h before infection with inhibition ranging from 39% to 69%, for all tested concentrations. Figure 2 shows the direct effect of SPLSAp on PV-1 (virucidal activity) resulting in inhibition of 74.1%, 72.8%, 59.3%, and 45.7% at 100 μg/mL, 50 μg/mL, 25 μg/mL, and 12.5 μg/mL, respectively. The inhibition of adsorption assay presented the following figures 68.9%, 67.2%, 49.2%, and 32.8%, respectively, for the same concentrations. Interferon, used as positive control in PRA, inhibited 100% of PV-1 at the concentration of 10,000 U/mL. The IFA was carried out to evaluate the effect of the SPLSAp in the expression of viral protein. It was performed with cells treated at the time 0 h of infection, at the concentrations of 12.5 μg/mL to 100 μg/mL and the inhibition of fluorescent cells varied from 70.9% to 100% (Table 2). The inhibition of viral RNA by the compound was demonstrated by RT-PCR. The SPLSAp inhibited viral RNA synthesis at the concentrations 12.5–100 μg/mL. The replicon was visualized only at low concentrations of the SPLSAp—6.25 μg/mL, 3.12 μg/mL, and 1.56 μg/mL (Figure 3). The replicon of cells infected and treated with human alfa-2B was not observed in the electrophoresis gel, and therefore, not shown.

tab1
Table 1: The antiviral activity of the Adenanthera pavonina sulfated polysaccharide (SPLSAp) against poliovirus. Evaluation under the assays of the time of addition (0 h), virucidal, and inhibition of adsorption, monitored by plaque reduction assay (PRA).
tab2
Table 2: The effect of the Adenanthera pavonina sulfated polysaccharide (SPLSAp) in the synthesis of PV-1 protein by immunofluorescence assay. The SPLSAp was used at the time 0 h of the infection at the indicated concentrations. Results are expressed by the mean ± SD of the fluorescent cells number and the corresponding % viral inhibition (% VI).
712634.fig.001
Figure 1: Effect of the time-of-addition assay of the Adenanthera pavonina sulfated polysaccharide (SPLSAp) on poliovirus type 1 (PV-1) in HEp-2 cells by plaque reduction assay. The percentage of viral inhibition (%VI) is expressed as mean ± SD of triplicate independent experiments.
712634.fig.002
Figure 2: The effect of the Adenanthera pavonina sulfated polysaccharide (SPLSAp) on poliovirus type 1 (PV-1) particle (virucidal activity) and in virus adsorption on HEp-2 cells by plaque reduction assay. The percentage of viral inhibition (%VI) is expressed as the mean ± SD of triplicate independent experiments.
712634.fig.003
Figure 3: The effect of the Adenanthera pavonina sulfated polysaccharide (SPLSAp) in the synthesis of PV-1 RNA monitored by RT-PCR. Polyacrylamide gel electrophoresis of amplicon for PV-1 VP1-VP4 (102 bp). Negative control (BLK); MW marker (Mw); cell control (CC); virus control (VC), and PV-1 treated with SPLSAp at the indicated concentrations (1.56–25 μg/mL).

4. Discussion

Currently, the anti-PV activity of natural products has been stimulated. Soltan and Zaki [32] reported that four out of forty-two Egyptian medicinal plants showed antiviral effect against PV. The anti-PV activity was also demonstrated with extract from Avicennia marina [33], with an Agaricus brasiliensis polysaccharide [22] and with four polysaccharides from Azadirachta indica [23]. In this study, we demonstrated the anti-PV action of the SPLSAp. The SPLSAp showed low cytotoxicity and IC50 (1.18 μg/mL) resulting in a high SI, one of the features sought for a potential candidate for antiviral. Similarly, IC50 (1.73 μg/mL) was found with a sulfated polysaccharide from Caesalpinia ferrea seeds, also a galactomannan [18]. According to Cerqueira et al. [26], the galactomannans extracted from seeds of numerous plants (particularly theLeguminosae) are polysaccharides built up of a β-(1-4)-d-mannan backbone with single d-galactose branches linked β-(1-6), with predominance of β-glucans, to which the antiviral activity may be attributed.

The time-of-addition assay was performed to investigate the possible steps of the SPLSAp action mechanism in the replication of PV. The SPLSAp used at the times 0, 1, 2, 4, and 8 h p.i (Figure 1) showed that the maximum PV inhibition was observed at the time 0 h, suggesting that the compound inhibited mainly the initial stages of viral infection. This result is in agreement with reports on the antiviral property of high-molecular-weight compounds. Sulfated polysaccharides are among the most studied and have demonstrated an in vitro broad spectrum of antiviral activity. This property is thought to be related to distinct structural characteristics and not only to high charge density or chain length. These compounds can potentially block early stages of viral replication, including attachment to the target cell and viral entry [2, 34]. The sulfation provides a negative charge density greater than natural compound, interfering most efficiently with electrostatic interactions between the positive charges of the viral proteins and cell receptors, usually with negative charges [2, 35]. To substantiate this feature, we analyzed the SPLSAp effect directly on viral particles (virucidal assay) and its interaction with cell receptors (inhibition of adsorption assay) resulting in low activity. The presence of β-glucans in the SPLSAp and the possibility of interferon induction cannot be ruled out, as suggested by Biesert et al. [36]. We also demonstrated that SPLSAp showed effect when used after infection. The SPLSAp could also present low-molecular-weight polysaccharide components eliciting antiviral effect in steps after virus entry into the cells [2]. This hypothesis could explain the inhibition of viral protein expression or the posttranslational polyprotein cleavage and the inhibition of viral RNA synthesis, as we also demonstrated, and concur with the whole SPLSAp anti-PV effect.

5. Conclusion

Our results showed that SPLSAp inhibits the growth of PV in more than one step of its replicative cycle, suggesting more than one mechanism of antiviral action. In addition, the compound is endowed with a low cytotoxicity and, therefore, can be a candidate for further development of an antipoliovirus agent.

Conflict of Interests

The authors declare that there is no conflict of interests.

Acknowledgments

The authors wish to thank CNPq, CAPES, and Fundação Araucária for financial aid.

References

  1. J. Hupfeld and T. Efferth, “Drug resistance of human immunodeficiency virus and overcoming it by natural products,” In Vivo, vol. 23, no. 1, pp. 1–6, 2009. View at Google Scholar · View at Scopus
  2. T. Ghosh, K. Chattopadhyay, M. Marschall, P. Karmakar, P. Mandal, and B. Ray, “Focus on antivirally active sulfated polysaccharides: from structure-activity analysis to clinical evaluation,” Glycobiology, vol. 19, no. 1, pp. 2–15, 2009. View at Publisher · View at Google Scholar · View at Scopus
  3. A. Josephine, G. Amudha, C. K. Veena, S. P. Preetha, A. Rajeswari, and P. Varalakshmi, “Beneficial effects of sulfated polysaccharides from Sargassum wightii against mitochondrial alterations induced by Cyclosporine A in rat kidney,” Molecular Nutrition & Food Research, vol. 51, no. 11, pp. 1413–1422, 2007. View at Publisher · View at Google Scholar · View at Scopus
  4. P. L. R. Cunha, R. C. M. Paula, and J. P. A. Feitosa, “Polissacarídeos da biodiversidade brasileira: uma oportunidade de transformar conhecimento em valor econômico,” Química Nova, vol. 32, no. 3, pp. 649–660, 2009. View at Publisher · View at Google Scholar
  5. R. Sultana and T. Gulzar, “Proximate analysis of Adenanthera pavonina L. seed oil, a source of lignoceric acid grown in Pakistan,” Journal of the American Oil Chemists' Society, vol. 89, no. 9, pp. 1611–1618, 2012. View at Publisher · View at Google Scholar · View at Scopus
  6. S. Fonseca and S. Perez, “Ação do polietilenoglicol na germinação de sementes de Adenanthera pavonina L. e o uso de poliaminas na atenuação do estresse hídrico sob diferentes temperaturas,” Revista Brasileira de Sementes, vol. 25, no. 1, pp. 1–6, 2003. View at Google Scholar
  7. R. K. Soomro and S. T. H. Sherazi, “Spectroscopic and chromatographic evaluation of the wax ester fraction of Adenanthera pavonina oil,” Industrial Crops and Products, vol. 36, no. 1, pp. 294–298, 2012. View at Publisher · View at Google Scholar · View at Scopus
  8. A. Krishnaveni, S. Selvi, and S. Mohandass, “Antidiabetic, hypolipidemic activity of Adenanthera pavonina seeds in alloxan induced diabetic rats,” Journal of Pharmacy Research, vol. 4, no. 5, pp. 1440–1442, 2011. View at Google Scholar
  9. A. D. A. Adedapo, Y. O. Osude, A. A. Adedapo et al., “Blood pressure lowering effect of Adenanthera pavonina seed extract on normotensive rats,” Records of Natural Products, vol. 3, no. 2, pp. 82–89, 2009. View at Google Scholar
  10. A. Ara, M. M. Saleh-e-In, N. U. Ahmed, M. Ahmed, M. A. H. Hashem, and S. C. Bachar, “Phytochemical screening, analgesic, antimicrobial and anti-oxidant activities of bark extracts of Adenanthera pavonina l. (Fabaceae),” Advances in Natural and Applied Sciences, vol. 4, no. 3, pp. 352–360, 2010. View at Google Scholar · View at Scopus
  11. J. R. Soares, A. Q. de Carvalho, I. S. Dos Santos et al., “Antimicrobial peptides from Adenanthera pavonina L. Seeds: characterization and antifungal activity,” Protein and Peptide Letters, vol. 19, no. 5, pp. 520–529, 2012. View at Publisher · View at Google Scholar · View at Scopus
  12. V. R. Racaniello, “Picornaviridae: the viruses and their replication,” in Fields Virology, D. M. Knipe and P. M. Howley, Eds., pp. 796–837, Lippincott Williams & Wilkins, Philadelphia, Pa, USA, 5th edition, 2007. View at Google Scholar
  13. Global Polio Eradication Iniciative, “Annual report 2014,” WHO press, World Health Organization, Geneva, Switzerland, 2014.
  14. Í. G. P. Vieira, F. N. P. Mendes, M. I. Gallão, and E. S. de Brito, “NMR study of galactomannans from the seeds of mesquite tree (Prosopis juliflora (Sw) DC),” Food Chemistry, vol. 101, no. 1, pp. 70–73, 2007. View at Publisher · View at Google Scholar · View at Scopus
  15. A. N. O'Neill, “Sulphated derivatives of laminarin,” Canadian Journal of Chemistry, vol. 33, no. 6, pp. 1097–1101, 1995. View at Google Scholar
  16. L. Ono, W. Wollinger, I. M. Rocco, T. L. M. Coimbra, P. A. J. Gorin, and M. Sierakowski, “In vitro and in vivo antiviral properties of sulfated galactomannans against yellow fever virus (BeH111 strain) and dengue 1 virus (Hawaii strain),” Antiviral Research, vol. 60, no. 3, pp. 201–208, 2003. View at Publisher · View at Google Scholar · View at Scopus
  17. L. Wang, X. Li, and Z. Chen, “Sulfated modification of the polysaccharides obtained from defatted rice bran and their antitumor activities,” International Journal of Biological Macromolecules, vol. 44, no. 2, pp. 211–214, 2009. View at Publisher · View at Google Scholar · View at Scopus
  18. K. A. Yamamoto, L. C. F. Galhardi, V. P. Rincão et al., “Antiherpetic activity of an Agaricus brasiliensis polysaccharide, its sulfated derivative and fractions,” International Journal of Biological Macromolecules, vol. 52, no. 1, pp. 9–13, 2013. View at Publisher · View at Google Scholar · View at Scopus
  19. N. Lopes, L. C. Faccin-Galhardi, S. F. Espada et al., “Sulfated polysaccharide of Caesalpinia ferrea inhibits herpes simplex virus and poliovirus,” International Journal of Biological Macromolecules, vol. 60, pp. 93–99, 2013. View at Publisher · View at Google Scholar · View at Scopus
  20. T. Nishimura, H. Toku, and H. Fukuyasu, “Antiviral compounds. XII. Antiviral activity of amidinohydrazones of alkoxyphenyl-substituted carbonyl compounds against influenza virus in eggs and in mice,” Kitazato Archives of Experimental Medicine, vol. 50, no. 1-2, pp. 39–46, 1977. View at Google Scholar · View at Scopus
  21. M. C. Minari, V. P. Rincão, S. A. Soares, N. M. P. S. Ricardo, C. Nozawa, and R. E. C. Linhares, “Antiviral properties of polysaccharides from Agaricus brasiliensis in the replication of bovine herpesvirus 1,” Acta Virologica, vol. 55, no. 3, pp. 255–259, 2011. View at Publisher · View at Google Scholar · View at Scopus
  22. L. C. Faccin, F. Benati, V. P. Rincão et al., “Antiviral activity of aqueous and ethanol extracts and of an isolated polysaccharide from Agaricus brasiliensis against poliovirus type 1,” Letters in Applied Microbiology, vol. 45, no. 1, pp. 24–28, 2007. View at Publisher · View at Google Scholar · View at Scopus
  23. L. C. Faccin-Galhardi, K. Aimi Yamamoto, S. Ray, B. Ray, R. E. Carvalho Linhares, and C. Nozawa, “The in vitro antiviral property of Azadirachta indica polysaccharides for poliovirus,” Journal of Ethnopharmacology, vol. 142, no. 1, pp. 86–90, 2012. View at Publisher · View at Google Scholar · View at Scopus
  24. C. Mähner, M. D. Lechner, and E. Nordmeier, “Synthesis and characterisation of dextran and pullulan sulphate,” Carbohydrate Research, vol. 331, no. 2, pp. 203–208, 2001. View at Publisher · View at Google Scholar · View at Scopus
  25. J. Yang, Y. Du, Y. Wen, T. Li, and L. Hu, “Sulfation of Chinese lacquer polysaccharides in different solvents,” Carbohydrate Polymers, vol. 52, no. 4, pp. 397–403, 2003. View at Publisher · View at Google Scholar · View at Scopus
  26. M. A. Cerqueira, B. W. S. Souza, J. Simões et al., “Structural and thermal characterization of galactomannans from non-conventional sources,” Carbohydrate Polymers, vol. 83, no. 1, pp. 179–185, 2011. View at Publisher · View at Google Scholar · View at Scopus
  27. C. Hu, Q. Kong, D. Yang, and Y. Pan, “Isolation and structural characterization of a novel galactomannan from Eremurus anisopterus (Ker. et Kir) Regel roots,” Carbohydrate Polymers, vol. 84, no. 1, pp. 402–406, 2011. View at Publisher · View at Google Scholar · View at Scopus
  28. M. S. Shobha, A. B. Vishu Kumar, R. N. Tharanathan, R. Koka, and A. K. Gaonkar, “Modification of guar galactomannan with the aid of Aspergillus niger pectinase,” Carbohydrate Polymers, vol. 62, no. 3, pp. 267–273, 2005. View at Publisher · View at Google Scholar · View at Scopus
  29. D. Mudgil, S. Barak, and B. S. Khatkar, “X-ray diffraction, IR spectroscopy and thermal characterization of partially hydrolyzed guar gum,” International Journal of Biological Macromolecules, vol. 50, no. 4, pp. 1035–1039, 2012. View at Publisher · View at Google Scholar · View at Scopus
  30. S. D. Figueiró, J. C. Góes, R. A. Moreira, and A. S. B. Sombra, “On the physico-chemical and dielectric properties of glutaraldehyde crosslinked galactomannan-collagen films,” Carbohydrate Polymers, vol. 56, no. 3, pp. 313–320, 2004. View at Publisher · View at Google Scholar · View at Scopus
  31. F. Chrestani, M. R. Sierakowski, D. E. de Andrade Uchoa et al., “In vitro antiherpetic and antirotaviral activities of a sulfate prepared from Mimosa scabrella galactomannan,” International Journal of Biological Macromolecules, vol. 45, no. 5, pp. 453–457, 2009. View at Publisher · View at Google Scholar · View at Scopus
  32. M. M. Soltan and A. K. Zaki, “Antiviral screening of forty-two Egyptian medicinal plants,” Journal of Ethnopharmacology, vol. 126, no. 1, pp. 102–107, 2009. View at Publisher · View at Google Scholar · View at Scopus
  33. K. Zandi, M. Taherzadeh, S. Tajbakhsh, R. Yaghoubi, Z. Rastian, and K. Sartavi, “Antiviral activity of Avicennia marina leaf extract on HSV-1 and vaccine strain of polio virus in vero cells,” International Journal of Infectious Diseases, vol. 12, supplement 1, p. e298, 2008. View at Publisher · View at Google Scholar
  34. X. Song, Z. Yin, L. Li et al., “Antiviral activity of sulfated Chuanminshen violaceum polysaccharide against duck enteritis virus in vitro,” Antiviral Research, vol. 98, no. 2, pp. 344–351, 2013. View at Publisher · View at Google Scholar · View at Scopus
  35. S. Saha, L. C. F. Galhardi, K. A. Yamamoto et al., “Water-extracted polysaccharides from Azadirachta indica leaves: structural features, chemical modification and anti-bovine herpesvirus type 1 (BoHV-1) activity,” International Journal of Biological Macromolecules, vol. 47, no. 5, pp. 640–645, 2010. View at Publisher · View at Google Scholar · View at Scopus
  36. L. Biesert, M. Adamski, G. Zimmer et al., “Anti-human immunodeficiency virus (HIV) drug HOE/BAY 946 increases membrane hydrophobicity of human lymphocytes and specifically suppresses HIV-protein synthesis,” Medical Microbiology and Immunology, vol. 179, no. 6, pp. 307–321, 1990. View at Google Scholar · View at Scopus