Research Article
Integrated Analysis for Identifying Radix Astragali and Its Adulterants Based on DNA Barcoding
Table 2
Primers and PCR reaction conditions.
| Primer name | Primer sequences (5′-3′) | PCR reaction condition |
| ITS2 | | | 2F | ATGCGATACTTGGTGTGAAT | 94°C 5 min; | 3R | GACGCTTCTCCAGACTACAAT | 94°C 30 s, 56°C 30 s, 72°C 45 s, 40 cycles; 72°C 10 min; | ITS | | | 4R | TCCTCCGCTTATTGATATGC | 94°C 5 min; | 5F | GGAAGTAAAAGTCGTAACAAGG | 94°C 1 min, 50°C 1 min, 72°C 1.5 min + 3 s/cycle, 30 cycles; 72°C 7 min; | psbA | | | fwdPA | GTTATGCATGAACGTAATGCTC | 94°C 4 min; | trnH | | | rev TH | CGCGCATGGTGGATTCACAATCC | 94°C 30 s, 55°C 1 min, 72°C 1 min, 35 cycles; 72°C 10 min; |
|
|