Effect of Nourishing “Yin” Removing “Fire” Chinese Herbal Mixture on Hypothalamic Mammalian Target of Rapamycin Expression during Onset of Puberty in Female Rats

<div class="floats-full-page floats-full-page-other"><h2>Table 2</h2><div class="floats-full-page-caption">Primer sequences. </div><div class="floats-full-page-content"><table class="table-group" id="tab2"><tr><td><table class="table"><tr><td class="thead-hr" colspan="3"><hr /></td></tr><tr class="thead"><td align="left">Name of gene</td><td align="center">Primer sequence (5′ to 3′)</td><td align="center">Amplification fraction</td></tr><tr><td class="thead-hr" colspan="3"><hr /></td></tr><tr><td align="left" rowspan="2">GAPDH</td><td align="center">Forward: ACTTTGGCATCGTGGAAGGG</td><td align="center" rowspan="2">128 bp</td></tr><tr><td align="center">Reverse: TGCAGGGATGATGTTCTGGG</td></tr><tr><td align="center" colspan="3"><hr /></td></tr><tr><td align="left" rowspan="2">mTOR</td><td align="center">Forward: CAATTATACTCGCTCCCTGGCT</td><td align="center" rowspan="2">131 bp</td></tr><tr><td align="center">Reverse: AGCAGTCCCCAAAGTCAATGT</td></tr><tr class="table-tr"><td colspan="3"><hr class="tbody-hr" /></td></tr></table></td></tr></table></div></div>

Table 2 | Effect of Nourishing “Yin” Removing “Fire” Chinese Herbal Mixture on Hypothalamic Mammalian Target of Rapamycin Expression during Onset of Puberty in Female Rats

title

Table 2: Effect of Nourishing “Yin” Removing “Fire” Chinese Herbal Mixture on Hypothalamic Mammalian Target of Rapamycin Expression during Onset of Puberty in Female Rats

description

Table 2

About this journal

<p><em>Evidence-Based Complementary and Alternative Medicine</em> seeks to apply scientific rigor to the study of complementary and alternative medicine, emphasizing on health outcome, while documenting biological mechanisms of action.</p>


Journal profile

Meet the editorial board

<p><em>Evidence-Based Complementary and Alternative Medicine</em> maintains an Editorial Board of practicing researchers from around the world, to ensure manuscripts are handled by editors who are experts in the field of study.</p>


Editor spotlight

Submit to Special Issue

We currently have a number of Special Issues open for submission. Special Issues highlight emerging areas of research within a field, or provide a venue for a deeper investigation into an existing research area.