Evidence-Based Complementary and Alternative Medicine / 2015 / Article / Tab 2

Research Article

Effect of Nourishing “Yin” Removing “Fire” Chinese Herbal Mixture on Hypothalamic Mammalian Target of Rapamycin Expression during Onset of Puberty in Female Rats

Table 2

Primer sequences.

Name of genePrimer sequence (5′ to 3′)Amplification fraction

GAPDHForward: ACTTTGGCATCGTGGAAGGG128 bp
Reverse: TGCAGGGATGATGTTCTGGG

mTORForward: CAATTATACTCGCTCCCTGGCT131 bp
Reverse: AGCAGTCCCCAAAGTCAATGT