Evidence-Based Complementary and Alternative Medicine / 2015 / Article / Tab 1

Research Article

Investigation on Molecular Mechanism of Fibroblast Regulation and the Treatment of Recurrent Oral Ulcer by Shuizhongcao Granule-Containing Serum

Table 1

Real-time PCR primers.

GenePrimer sequence

GAPDHGGAGCGAGATCCCTCCAAAAT
GGCTGTTGTCATACTTCTCATGG

IL-10GCTATGTTGCCTGCTCTTACTG
TCTGGCTGACTGGGAAGTG

IL-12aAGACATCACACGGGACAAAAC
CACAGGGTCATCATCAAAGAAG

IL-12bAGCACTCCCCATTCCTACTTCT
AACGCACCTTTCTGGTTAC