Evidence-Based Complementary and Alternative Medicine / 2018 / Article / Tab 1

Research Article

Optimized Extract from Corylopsis coreana Uyeki (Hamamelidaceae) Flos Inhibits Osteoclast Differentiation

Table 1

Primer sequences used in this study.

Gene of interestDirectionPrimer sequence (5′–3′)

TRAPSenseGATGACTTTGCCAGTCAGCA
AntisenseACATAGCCCACACCGTTCTC
NFATc1SenseGGGTCAGTGTGACCGAAGAT
AntisenseGGAAGTCAGAAGTGGGTGGA
Cathepsin KSenseGGCCAACTCAAGAAGAAAAC
AntisenseGTGCTTGCTTCCCTTCTGG
OSCARSenseCTGCTGGTAACGGATCAGCTC
AntisenseCCAAGGAGCCAGAACCTT
GAPDHSenseAACTTTGGCATTGTGGAAGG
AntisenseACACATTGGGGGTAGGAACA