Table 2: Primer sequences for the polymerase chain reaction (PCR).

GenePrimerOligonucleotide sequence (5'-3')

GAPDHF5'CAATGAATACGGCTACAGCAAC3'
R5'AGGGAGATGCTCAGTGTTGG3'
iNOSF5'CCCTTCCGAAGTTTCTGGCAGCAGC3'
R5'GGCTGTCAGAGCCTCGTGGCTTTGG3'
COX-2F5’-TCTCAGCACCCACCCGCTCA-3’
R5’-GCCCCGTAGACCCTGCTCGA-3’
IL-1βF5'CAGGGTGGGTGTGCCGTCTTTC3'
R5'TGCTTCCAAACCTTTGACCTGGGC3'
TNF-ɑF5'TTGACCTCAGCGCTGAGTTG3'
R5'CCTGTAGCCCACGTCGTAGC3'
IL-6F5’-GTACTCCAGAAGACCAGAGG-3’
R5’-TGCTGGTGACAACCACGGCC-3’