Evidence-Based Complementary and Alternative Medicine / 2018 / Article / Tab 1

Research Article

Improvement of Learning and Memory Induced by Cordyceps Polypeptide Treatment and the Underlying Mechanism

Table 1

Primer pairs for the real-time quantitative PCR.

Gene nameTwo-way primer sequenceAnnealing temperature (°C)Product size (bp)

Pik3r5F: 5′ CGGCTTCTATTACTTCAACTTCCA3′  
R: 5′ CGGAGGAAGACTTGATAAACAGAC3′
6071
Il-1βF: 5′ CTTCAGGCAGGCAGTATCACTC3′  
R: 5′ GCAGTTGTCTAATGGGAACGTC3′
60194
Slc18a2F: 5′ TCACCAACCCATTCATAGGACT3′  
R: 5′ ATGAGCAAGAGGAGCCGATT3′
60168