Evidence-Based Complementary and Alternative Medicine

Evidence-Based Complementary and Alternative Medicine / 2019 / Article

Research Article | Open Access

Volume 2019 |Article ID 4538985 | 14 pages | https://doi.org/10.1155/2019/4538985

Cardioprotective Effect of Danhong Injection against Myocardial Infarction in Rats Is Critically Contributed by MicroRNAs

Academic Editor: Yuewen Gong
Received04 May 2019
Accepted01 Aug 2019
Published26 Aug 2019

Abstract

Background. Danhong injection (DHI) has been mainly used for the treatment of myocardial infarction, atherosclerosis, and coronary heart disease in clinical practice. Our previous studies have shown that DHI improves ventricular remodeling and preserves cardiac function in rats with myocardial infarction (MI). In this study, we focused on the potential mechanism of DHI in protecting cardiac function in MI rats. Methods. Sprague-Dawley rats were subjected to ligation of the left anterior descending coronary artery (LAD) to prepare a myocardial infarction (MI) model. After 14 day DHI intervention, cardiac function was measured by echocardiography and myocardial fibrosis was assessed by Masson staining. Differentiated miRNAs were screened using rat immunopathology miScript miRNA PCR arrays, and their results were verified by RT-PCR, immunofluorescence, and immunoblotting. Results. DHI treatment significantly reduced infarct size and improved cardiac function and hemodynamics in MI rats by echocardiography and morphology. miRNA PCR array results showed that DHI reversed 25 miRNAs known to be associated with inflammation and apoptosis. Moreover, the expression of inflammatory factors TNF-α, IL-1β, and IL-6 was significantly reduced in the treated DHI group. Mechanistically, DHI downregulated the inflammatory transcription factor NF-κB (as reflected by inhibition of NF-κB p65 nuclear translocation and phosphorylation of the IκBα). Conclusions. DHI is effective in mitigating inflammation associated with MI by preventing NF-κB nuclear translocation and regulating miRNAs, thereby improving cardiac function in myocardial infarction rats.

1. Introduction

Acute myocardial infarction (AMI) is a common cardiovascular disease with a high mortality rate [1]. Important medical and interventional therapies have been incorporated into the clinical guidelines and shown to reduce the incidence and mortality of acute myocardial infarction in randomized clinical trials [2]. Inflammation is frequently encountered in clinical practice, and various causes can cause myocardial inflammation and lead to defects in the myocardial structure and function [3, 4]. The inflammatory response is a prerequisite for scar formation and healing, which can reduce deleterious myocardial remodeling by promoting effective tissue repair after MI [5]. However, overproduction of inflammatory mediators and proinflammatory cytokines can lead to the deterioration of the pathological process. Inhibition of excessive inflammation may allow us to design effective inflammatory-related interventions for treating MI.

MicroRNAs (miRNAs) are endogenous, conserved, single-stranded, small (approximately 22 nucleotides), noncoding RNAs expressed in a cell and tissue-specific manner that regulate gene expression and organ function, including the myocardium [6]. miRNA plays a mediating role in gene expression by combining the 3′-UTR of target genes at the posttranscriptional level by either promoting degradation or inhibiting translation—repress gene expression [7]. Each miRNA can regulate several to hundreds of different target genes by inducing degradation of its target mRNA and inhibiting translation [8, 9]. It is widely recognized that miRNAs represent critical regulators of cardiovascular function and show potential as circulating biomarkers of cardiovascular diseases since the discovery of their presence and stability in peripheral blood [10, 11], Several studies reported miRNAs have a crucial role in the pathogenesis and progression of heart failure and a huge diagnostic potential in the setting of AMI and its ability to downregulate specific genomic network expressions [1216]. Increasing evidence shows that miRNAs play functional roles in the development of heart failure and a dysregulation of miRNA expression in the failing or hypertrophic heart [14, 1620]. Recent research reveals a crucial role of miRNAs as a mediator in the inflammation cascade [21].

More effective and safe anti-inflammatory agents are being investigated, including nonsteroidal anti-inflammatories and traditional Chinese medicine (TCM), with many more compounds under development, such as Xuebijing injection and Shenfu injection have been used for treating inflammatory response, and both of them have resulted in satisfactory effects [2224]. Danhong injection (DHI) is a standard extract from danshen (Salvia miltiorrhiza Bunge, Labiatae) and honghua (Carthamus tinctorius L, Compositae), which has been long used primarily for the treatment of ischemic encephalopathy and cardiac diseases including MI and angina in clinics [25, 26]. Our previous study showed that the main components of DHI contain the following substances: danshensu, hydroxysafflor yellow A, 5-hydroxymethyl-2-furfural, protocatechuic aldehyde, lithospermic acid, caffeic acid, salvianolic acid A, salvianolic acid B, salvianolic acid C, protocatechuic acid, and rosmarinic acid [27]. And research has showed that DHI prevented the lipopolysaccharide-stimulated systemic acute inflammatory reaction via inhibiting the expressions of iNOS, COX-2, IL-1β, IL-6, MCP-1, and TNF-α [28]. This result suggests that DHI may act on several targets to alleviate inflammation.

We recently reported that DHI could be used for ventricular remodeling after MI [29]. In this present study, we mainly investigated whether DHI could delay ventricular remodeling and protect cardiac function by inhibiting inflammation in the MI model and its mechanism of action.

2. Materials and Methods

2.1. Drugs and Reagents

DHI (Country Medicine Accurate Character Number: Z20026866, Batch number: 13062020) was obtained from Heze Buchang Pharmaceutical Co., Ltd. China. Valsartan (Batch number: X1651) was obtained from Beijing Novartis Pharma Co., Ltd. China. Chloral hydrate (Batch number: Q/12HB 4218-2009) was purchased from Tianjin Kermel Chemical Reagent Co., Ltd. China.

The Bcl-2 (PAA778Ra81) and caspase-3 (PAA626Ra81) primary antibodies were purchased from Uscn Life Science Inc. (Wuhan, China). The α-sarcomeric actin primary antibodies were purchased from Sigma Chemical Company (USA). Primary antibodies anti-phospho-p65 (ab86299), anti-phospho-IκB-α (ab12135), anti-IκB-α (ab109300), and anti-Lamin B1 (ab133741) were purchased from Abcam Inc. (Cambridge, UK). The anti-p65 (CST3034s) and anti-GAPDH (CST5174) primary antibodies and the secondary antibodies were obtained from Cell Signaling Technology (Danvers, MA, USA). The tumor necrosis factor-alpha (TNF-α), interleukin-1β (IL-1β), and interleukin-6 (IL-6) assay kit were from Uscn Life Science Inc. (Wuhan, China).

2.2. Quality Control of DHI

According to the National Drugs surveillance administrative bureau standard WS-11220, the total amount of danshensu (molecular formula: C9H10O5) and protocatechuic aldehyde (molecular formula: C7H6O3) should not be lower than 0.5 mg in 1 mL DHI analyzed by high-performance liquid chromatography (HPLC) as a reference in 1 mL injection. Simultaneously, the content of the total flavonoids determined by visible light spectrophotometry should not be lower than 5.0 mg/mL against rutin (molecular formula: C27H30O16) as a reference in 1 ml injection [30].

As early as 2012, our laboratory has established a dual-standard quality assessment of DHI [27]. HPLC fingerprinting of DHI has been performed on the ACQUITY UHPLC BEH C18 column (2.1 × 150 mm2, 1.7 m) and an C18 guard column. The quality control of the DHI method is as follows. The flow rate was 0.3 mL/min. The column temperature was 30°C. The mobile phase comprised (A) aqueous phosphoric acid (0.2%, v/v) and (B) acetonitrile using a gradient elution of 5–5% B at 0–3 min, 20–20% B at 15–20 min, 27–27% B at 25–28 min, and 27–70% B at 28–30 min, and the reequilibration time of gradient elution was 2 min. Moreover, the detection wavelength was set at 280 nm [31].

2.3. Animals

Male Sprague-Dawley rats, weighing 220–250 g, was purchased from Beijing HFK Bioscience. Co., Ltd. The rats were raised at 12 h dark/light cycle with a temperature of 22 ± 2°C and humidity of 40 ± 5%. Standard rat chow and clean drinking water were provided ad libitum.

The study was carried out in accordance with the recommendations in the guidance for the Care and Use of Laboratory Animals issued by the Ministry of Science and Technology, China. All animal experiments and procedures were approved by Tianjin University of Traditional Chinese Medicine (TCM) Laboratory Animal Ethical Committee (TCM-LAEC2017026), and all procedures were performed to reduce the number and animals and suffering during the experiments.

Rats were anesthetized with chloral hydrate (5%, peritoneal injection, 300 mg/kg). Adequacy of anesthesia was controlled by monitoring corneal reflex and the lack of response to toe-pinching. Euthanasia was performed by excessive inhalation of isoflurane. Death was monitored by the cardiac activity and respiration.

2.4. Inducing Myocardial Infarction in a Rat and Drug Administration

For the MI rat model, the left anterior descending (LAD) coronary artery was subjected to ligation according to the previous studies [32], and the specific process was carried out as previously reported [29].

Rats were randomly divided into four groups (n = 10/group): (1) sham (normal saline, intramuscular); (2) model (normal saline, intramuscular); (3) DHI (DHI, intramuscular); (4) valsartan (intragastric). The clinically used dosage of DHI and valsartan was converted for use in our experiment 0.76 ml/kg/day and 10 mg/kg/day, respectively. The substances were routinely administration for 14 days.

2.5. Echocardiographic and Hemodynamic Assessment of Left Ventricular Function

The functionality of the left ventricle was evaluated at 14 days after MI, using a Vevo 2100 Ultrahigh resolution small animal ultrasound imaging system in real time (VisualSonicsVevo 2100, Canada), as previously described [33]. The cannulation was done to the left ventricle through the right carotid artery, which was connected to a biofunction experiment system MP100-CE (BIOPAC systems Inc., Santa Barbara, California, USA) at the end of the echocardiography experiment. The detailed procedure is described in our earlier report [29].

2.6. MicroRNA PCR Array

The total RNA was extracted from the LV samples (Infarct border zone, 30 mg/each rat) with miRNeasy Mini kit (Qiagen, Germany) according to the manufacturer’s instructions. The RNA samples (2 μg) were reverse transcribed to cDNA with the miScript II RT kit (Qiagen, German). The reaction system and conditions are shown in Table 1.


Array format: componentVolumeReaction conditions

5x miScript HiSpec Buffer4 μl
10x miScript Nucleics Mix2 μl
RNase-free waterVariable37°C 60 min
miScript Reverse Transcriptase Mix2 μl95°C 5 min
Template RNA (added in step 3)Variable
Total volume20 μl

Using miScript PCR Starter Mix Reagent kits (Qiagen) and miScript miRNA PCR arrays (rat immunopathology miRNA PCR array: MIRN-104Z) to run the Q-PCRs, miRNAs expression was confirmed by specific primers. The reaction system and cycling conditions are shown in Tables 2 and 3.


Array format: componentVolume (96-well)

2x QuantiTect SYBR Green PCR Master Mix1375 μl
10x miScript Primer assay275 μl
RNase-free water1000 μl
Template cDNA100 μl
Total volume2750 μl

Note. Ensure whether the cDNA was diluted 10 times (25 μl per well).

StepTimeTemperature

PCR initial activation step15 min95°C
3-step cycling
Denaturation15 s94 C
Annealing15 s55 C
Extension30 s70 C
Cycle number40 cycles

2.7. Quantitative Real-Time PCR

Real-time PCR in a StepOne Real-Time PCR system (Applied Biosystems) was used to determine the cardiac mRNA expression of IL-1β, TNF-α, caspase-3, Bcl-2, and GAPDH. The sequences of the sense and antisense primers used for amplification are shown in Table 4.


mRNA (rat)Sequence

TNF-αForward5′GAAGAGAACCTGGGAGTAGATAAGG3′
Reverse5′GTCGTAGCAAACCACCAAGC3′
IL-1βForward5′TCGTTGCTTGTCTCTCCTTG3′
Reverse5′AAAAATGCCTCGTGCTGTCT3′
Bcl-2Forward5′ACAGCCAGGAGAAATCAAACA3′
Reverse5′GGTGGACAACATCGCTCTG3′
Caspase-3Forward5′AGTTTCGGCTTTCCAGTCAG3′
Reverse5′AGTTGGCATGGTAGCCCTTG3′
GAPDHForward5′GGAGCAGTTTTGTGTGTGTGA3′
Reverse5′CTGGAAGATGGTGATGGGTT3′

2.8. Serum Biochemical Indices

At the 7th and 14th day after surgery, tagged as the inflammatory reaction period, serum was also collected from the rats. The levels of inflammatory factors which involve TNF-α, IL-1β, and IL-6 were measured by commercially available ELISA kits according to the manufacturer’s instructions.

2.9. Western Blot Analysis

Myocardial tissues were cut from the infarct border zone. Cytosolic and nuclear proteins were extracted from the infarct border zone of the heart tissue using NE-PER nuclear and cytoplasmic extraction reagents according to the manufacturer’s instructions (Thermo Scientific, USA). Proteins were separated by SDS-PAGE (8–10%) and probed with different primary antibodies against p-P65, NF-κB, p-IκB-α, GAPDH, and Lamin B.

2.10. Histopathological Examination

Myocyte size and interstitial fibrosis were shown by pathological section. Pathological examination was performed using the paraffin sections and stained with hematoxylin and eosin (H&E) and Masson trichrome. Infarct size measurements were performed by measuring the midline length [34].

2.11. Immunofluorescence

Immunofluorescence was performed with standard protocols on the basis of H&E staining. Cardiomyocytes were marked with sarcomeric actin (A2172, Sigma), while DAPI (70317525, Roche) was used as the nucleus marker. Apoptosis was determined by expression of cleaved caspase-3 (PAA626Ra81, USCN) and Bcl-2 (PAA778Ra81, USCN). Fluorescence images were captured by use of OLYMPUS DP71 inverted fluorescence microscopy.

2.12. Statistical Analysis

All data in the experiment were expressed as mean ± SD. Data analyses were performed using the SPSS 17.0 software package. Statistical analysis was assessed by the analysis of variance (ANOVA) followed by the LSD test or Dunnett’s t-test for multiple comparisons. The differences were considered statistically significant at the value of .

3. Results

3.1. Treatment with DHI Improves Cardiac Performance and Hemodynamics in the MI Rat Model

Cardiac function was measured 14 days afterward via echocardiographic assessments (LVEF, LVFS, LVAWs, LVIDs, LVVOLs, and Tei value). LVEF, LVFS, and LVAWs were significantly greater in rats administered with DHI and valsartan than in those treated with saline, while LVIDs, LVVOLs, and Tei value were significantly smaller (Figures 1(a)1(f)). The representative echocardiograms in different groups are presented in Figure 1(m). Hemodynamic parameters measured via an intracardiac Millar catheter are presented in Figures 1(g)1(j). Rats with MI developed systolic dysfunction, as evidenced by significantly decreased LVSP and the maximum rate of rising in LV pressure (+dp/dt max), also exhibited a severe diastolic dysfunction, as defined by elevated LVEDP and the maximum rate of decline in LV pressure (−dp/dt max) in the model group than the sham group. DHI and valsartan administration significantly improved systolic cardiac function, enhancing LVSP and +dp/dt max, and provided beneficial effects on the diastolic function by reducing LVEDP and −dp/dt max compared to saline-treated rats (). DHI significantly ameliorates cardiac function, by increasing SW (5951.33 ± 1313.81 compared to the model ; ), whereas HR did not differ significantly between all groups at 2 weeks after MI (Figures 1(k) and 1(l)).

3.2. Myocardium Histology

We directly observed the effect of DHI on the myocardial structure and gross morphology after myocardial infarction by H&E and Masson staining (Figure 2). Morphological observation of H&E staining showed increase in myocardial hypertrophy and cell gap, loose of the structural arrangement of myocardial cells, rupture of myocardial fibers, and inflammatory cell infiltration, while a relative slighter condition in drug-treated groups was observed (Figure 2(a)). Less myocardial fibrosis is found in the heart after DHI and valsartan treatment as demonstrated by Masson staining (Figure 2(b)). Interstitial collagen density was markedly increased in the LV myocardium of the rat model than the sham group. Treatment with DHI significantly reversed this effect. The statistical infarction ratio was conducted by the application of the midline method. Compared with the model group, ratio of infarct was markedly decreased in the DHI and valsartan treatment group (Figure 2(c)).

3.3. MircoRNA Expression Pattern in DHI-Treated MI Rats Model

The rat immunopathology miScript miRNA PCR array was applied to screen for differential miRNA, and the miRNA PCR array result revealed that there were 5 upregulated and 15 downregulated miRNAs genes (fold change > 2) in the model group compared to the sham group and 25 upregulated miRNAs genes (fold change > 2) in the DHI-treated group compared to the model group. These significant differences in miRNAs are related to the immune response and inflammation, as shown in Tables 5 and 6.


PositionMature IDFold regulation

1rno-let-7a-5p−3.5319
2rno-let-7d-5p−2.0171
3rno-let-7f-5p−3.7884
4rno-miR-126a-3p−2.9236
5rno-miR-128-3p−2.0136
6rno-miR-150-5p−3.8158
7rno-miR-191a-5p−2.1912
8rno-miR-142-5p−2.4379
9rno-miR-26b-5p−3.9403
10rno-miR-29b-3p−2.7301
11rno-miR-30b-5p−2.3728
12rno-miR-30c-5p−2.3302
13rno-miR-30e-5p−2.243
14rno-miR-26a-5p−2.2767
15rno-miR-409a-3p−2.5957

1rno-miR-146b-5p4.1473
2rno-miR-21-5p2.6806
3rno-miR-214-3p5.1766
4rno-miR-383-5p2.1495
5rno-miR-31a-5p45.4912


PositionMature IDFold regulationPredicted target genes

1rno-let-7a-5p4.8760IL-10, Ccl11
2rno-let-7c-5p2.2401IL-10, Ccl11
3rno-let-7d-5p2.4142IL-10, Ccl11
4rno-let-7e-5p2.2876IL-10, Ccl11, Fadd
5rno-let-7f-5p2.8107IL-10, Ccl11
6rno-miR-103-3p2.0075Cxcl12, IL-1β, Fadd
7rno-miR-129-5p2.1133Nox4, Vegf, Cxcl1, IL-7, Casp3
8rno-miR-130a-3p2.2469Ccl2, Tnf, Cxcl12, Cxcl13
9rno-miR-142-5p3.1912Tlr2, Cxcl12, Casp3, iNOS
10rno-miR-143-3p2.3556Cxcl11, Cd40, Cxcl12, iNOS
11rno-miR-15b-5p2.2214Cd40
12rno-miR-16-5p2.0139Cd40
13rno-miR-185-5p2.5885Ccl5, Crp, iNOS
14rno-miR-186-5p3.1615Cebpb, Cxcl12, Cxcl13, Ccl13, Tlr4, Cxcl1, IL-10
15rno-miR-191a-5p2.1983Cxcl11, Cxcl12, Cebpb
16rno-miR-2052.8986Cxcl12, Casp3, IL-1β, iNOS
17rno-miR-2072.3392Cxcl11, Cxcl12, Ccl21, serpinel, Crp, Cebpb
18rno-miR-210-3p2.3432Cxcl12
19rno-miR-26b-5p2.0389Vegf, tnf, Crp, Ccl3
20rno-miR-296-3p2.2710Cxcl1, IL-7
21rno-miR-299a-5p2.0430IL-10
22rno-miR-29b-3p3.9202Nox, Ccl21, Ccl3
23rno-miR-325-5p2.3339Ccl2, Cxcl12
24rno-miR-331-3p4.3646Serpinel, IL-1β
25rno-miR-409a-3p3.3666Casp3, IL-10

Positive values represent upregulation.
3.4. Role of miRNAs in the MI Rat Model as Revealed in Microarray-Based Bioinformatics Prediction

In order to obtain a better overview of miRNA expression signature, we further performed scatter diagram and unsupervised hierarchical clustering heat map analysis of differentially expressed miRNA by normalized probe signal values (Figures 3(a) and 3(b)). First and foremost, the miRNA PCR array was used to analyze miRNA expression profiles in the model and DHI group. Fold change > 2 and value < 0.05 between model and DHI group were set as the criteria for filtering differently expressed miRNAs. The scatter diagram result revealed that the expression of 25 miRNAs was strongly upregulated under 14-day DHI treatment. The heat map showed differentially expressed miRNA profiling.

According to the selected differentially expressed miRNA (fold change > 2), we have carried out the target gene prediction through the GeneSpring and microRNAorg database. The value of the predicted target gene was calculated by hypergeometric distribution. GO and KEGG analysis was performed on the target gene with using David software, and a miRNA-mRNA network was constructed.

In order to predict which possible functions and biological pathways were affected in the MI rat model and DHI group, we performed gene ontology (GO) and KEGG pathways analysis of 19 miRNAs which significantly changed after pretreatment with DHI. Bioinformatics analysis predicted that 19 miRNAs up- or downregulated 54 GOs significantly (refer miRNA-GO-network (Figure 3(c)) for more detailed information). Moreover, miRNA-KEGG signal pathway analysis revealed that the molecular pathways regulated by the differential miRNAs in the expression level mainly included the calcium signaling pathway, apoptosis, glycosylphosphatidylinositol-anchor biosynthesis, valine, leucine, and isoleucine degradation, PPAR signaling pathway, VEGF signaling pathway, natural killer cell-mediated cytotoxicity, purine metabolism, butanoate metabolism, amyotrophic lateral sclerosis, fatty acid metabolism, and long-term potentiation (Figure 3(d)).

The miRNA-mRNA network was constructed based on the relationship between differentially expressed miRNAs and their target genes. The results show that the differential miRNAs such as let-7a-5p, miR-103-3p, miR-142-5p, miR-143-3p, miR-185-5p, miR-186-5p, miR-26b-5p, miR-205, and miR-207 constituted intensive molecular networks and participated in the regulation of the immune response, e.g., TNF-α, IL-1β, and caspase-3 (Figure 3(e)), Table 6). This result poses an important question which led to the further experiment.

3.5. Effect of DHI on Prediction of Target Gene Expression

Based on miRNA PCR array results, hearts taken from rats in each of the experimental group were used for the confirmation of TNF-α, IL-1β, caspase-3, and Bcl-2 on the mRNA level (Figure 4). The RT-PCR result showed that mRNA expressions of TNF-α, IL-1β, and caspase-3 were markedly upregulated in the model group (, compared to the sham group). Interestingly, treatment with DHI and valsartan significantly downregulates mRNA expression of TNF-α and caspase-3 (), whereas DHI alone markedly reduced IL-1β mRNA expression () in the MI rat model. For the mRNA expression of Bcl-2, DHI and valsartan increased Bcl-2 mRNA expression notably ( and ).

3.6. Effects of DHI on the Serum Level of Inflammatory Cytokines

To further validate the prediction results, TNF-α, IL-1β, and IL-6 were measured in the serum at 14 days postsurgery. A shown in the results displayed in Figure 5, rats with MI had a higher serum level of TNF-α, IL-1β, and IL-6 concentration than that in the sham group (). These cytokines levels in the DHI group were significantly decreased ( and ), while the valsartan group showed the same effect, but there was no significant difference in IL-1β.

3.7. DHI Modulates NF-κB Signaling Pathway in the MI Rat Model

The effect of DHI on NF-κB pathway activation was examined in the cytoplasm and nucleus of cardiomyocytes from MI rats. The cytosolic phosphorylation of NF-κB and IκB-α was significantly enhanced in the model group; however, this change was notably inhibited by DHI and valsartan treatment (Figure 6(a)). Additionally, the nuclear expression of NF-κB was observed. Interestingly, MI not only increased the phosphorylation of NF-κB in the cytoplasm but also markedly enhanced the expression of NF-κB in the nuclear (, the model group compared with the sham group). However, Figure 6(b) showed that DHI and valsartan obviously inhibited the MI induced changes (, compared with the model group).

4. Discussion

A large number of evidence suggest that miRNAs play a critical role in diverse biological processes, such as embryogenesis, differentiation, carcinogenesis, immune system, inflammation, and viral infection, as well as involved in the physiological and pathophysiological processes such as cardiomyocytes apoptosis, angiogenesis, myocardial hypertrophy, ventricular remodeling, and heart failure in the cardiovascular system [6, 3537]. Robust evidence has shown that regulation of miRNAs has an inseparable relationship with inflammation. More and more miRNA have been reported to be involved in the regulation of the immune system, such as the release of inflammatory mediators [35]. Firstly, we observed that DHI could obviously improve the LVEF and LVFS and increase the LVSP and ±dp/dt max in MI rats, which show that DHI can improve cardiac function and hemodynamics in rats after MI. In order to explore the mechanism of DHI improving cardiac function in MI rats, we used microRNA PCR array to predict and analyze its target.

In the present study, we obtained differentially expressed miRNA in myocardial tissue after MI using miRNA PCR array. Microarray screening showed that the expression of 20 inflammatory-related miRNA was modified after myocardial infarction, including 5 upregulated miRNAs and 15 downregulated miRNAs (Table 5). After the intervention of DHI, it was found that 25 miRNAs expression was upregulated (Table 6). We found that DHI can upregulate 8 miRNAs (let-7a-5p, let-7d-5p, let-7f-5p, miR-191a-5p, miR-142-5p, miR-26b-5p, miR-29b-3p, and miR-409a-3p), which are downregulated in myocardial infarction rats. The discovery of these miRNAs will provide a basis for future research.

miRNA-mRNA network analysis forecast results showed that the common target gene (miR-103-3p, miR-205, and miR-331-3p) IL-1β (miR-205, miR-142-5p, miR-129-5p, and miR-409a-3p), caspase-3, and (miR-130a-3p and miR-26b-5p) TNF-α. We tested the above target genes through PCR and found that DHI does affect the expression of TNF-α, IL-1β, and caspase-3 mRNA. This result is consistent with the previous reports that miRNAs can also act directly on the mRNA of cytokines to attenuate the inflammatory response and maintain the body immune balance [38].

Another evidence is that TNF-α binds to homologous receptors to raise and activate caspase-8 in animal models and in humans subjects, which in turn activates the main executioner of apoptosis and caspase-3 [3941]. Moreover, miRNA-KEGG signal pathway analysis revealed that the differential miRNAs in the expression level regulating the molecular pathways mainly included the calcium signaling pathway, apoptosis, glycosylphosphatidylinositol-anchor biosynthesis, valine, leucine, and isoleucine degradation, PPAR signaling pathway, VEGF signaling pathway, natural killer cell-mediated cytotoxicity, purine metabolism, butanoate metabolism, amyotrophic lateral sclerosis, fatty acid metabolism, and long-term potentiation. DHI regulates these signaling pathways such as VEGF and apoptosis signaling pathway and has also been confirmed (data not shown). Therefore, our results suggest that DHI could protect the heart function of rats with MI by regulating miRNAs. This is a new mechanism by which DHI improves cardiac function in rats with myocardial infarction.

Another important evidence showed that IL-6 is the target for the Let-7 family of miRNAs, while Let-7 itself is also negatively regulated by TLR/NF-κB [42, 43]. In the present study, DHI can significantly inhibit NF-κB signaling pathway. It is well known that the transcription factor NF-κB is closely involved in the inflammatory cascade, manifested by increased NF-κB nuclear translocation, and promotes phosphorylation or degradation of IκB-α. NF-κB is a central transcriptional effector of inflammatory signaling which is involved in the regulation of cellular proliferation, differentiation, and apoptosis [31, 44]. Five subunits (RelA [p65], RelB, c-Rel, NF-κB 1 [p50], and NF-κB 2 [p52]) comprise the NF-κB family [45]. It has been reported that p65 and p50 heterodimers are the main types of NF-κB in cells and also the two most intensively studied subtypes of the NF-κB family at the moment [46, 47]. NF-κB activation and its subsequent nuclear translocation after MI trigger transcription of a large portfolio of genes including inflammatory cytokines (TNF-α, IL-1β, and IL-6), CXC, CC chemokines, and adhesion molecules [44]. Interestingly, our result agrees with the preservation of cardiomyocytes by DHI against inflammatory injury through the inhibition of the nuclear transcription of NF-κB and IκB-α phosphorylation. This indicates that DHI may have a pivotal role in alleviating the inflammatory injury caused by MI. These results provide evidence that the anti-inflammatory activity of DHI could be due to the regulation of the inflammation mediators via NF-κB pathway at the MI process.

Although this study elucidates that DHI could resist myocardial infarction to some extent by regulating microRNAs, there are still many miRNAs that need further research. In particular, how DHI regulates miRNAs to improve cardiac function is a problem worthy of further study.

5. Conclusion

In summary, our study confirmed that DHI ameliorates cardiac function and reduces myocardial infarct size via its anti-inflammatory effect through inhibiting NF-κB pathway and regulating miRNA. In brief, DHI prevents the deterioration of inflammatory response by inhibiting nuclear translocation of NF-κB and modulating inflammation-associated miRNA (such as miR-103-3p, miR-130a-3p miR-331-3p, miR-205, and miR-26b-5p), as well as regulating some target genes (TNF-α, IL-1β, and caspase-3) of the miRNA in the infarcted marginal zone. DHI inhibits myocardial cell apoptosis and promotes angiogenesis, thereby reducing infarct size and improving cardiac function. These findings may contribute to the understanding of molecular mechanisms involved in cardioprotection of DHI and provide novel insights into a future therapeutic strategy for early myocardial ischemia event.

Data Availability

The data used to support the findings of this study are available from the corresponding author upon request.

Conflicts of Interest

The authors declare that they have no conflicts of interest.

Authors’ Contributions

JC and JW designed the animal model, performed echocardiographic assessment of left ventricular function, western blot, and real-time PCR, and wrote the manuscript. JO analyzed the results of the miRNA experiment. ZY, HZ, and JY provided drugs and discussed interpretation. JN performed the histopathological examination. LL performed the hemodynamic assessment of left ventricular function. XG and GF conceived and designed the animal experiment. All the authors read and approved the final manuscript.

Acknowledgments

This work was financially supported by The Tianjin Science Fund for Distinguished Young Scholars (17JCJQJC46200), The National Key Basic Research Program of China (973 Program) (no. 2012CB518404), Tianjin Science and Technology Program: Tianjin TCM Clinical Medicine Research Center (no. 15ZXLCSY00020), and Special Project for the Construction of National Clinical Research Base of Traditional Chinese Medicine (JDZX2015006).

References

  1. C. H. Lee, C. L. Cheng, Y. H. Yang et al., “Trends in the incidence and management of acute myocardial infarction from 1999 to 2008: get with the guidelines performance measures in Taiwan,” Journal of the American Heart Association, vol. 3, no. 4, 2014. View at: Publisher Site | Google Scholar
  2. P. T. O’Gara, F. G. Kushner, D. D. Ascheim et al., “2013 ACCF/AHA guideline for the management of ST-elevation myocardial infarction: executive summary: a report of the American college of cardiology foundation/American heart association task force on practice guidelines,” Circulation, vol. 127, no. 4, pp. 529–555, 2013. View at: Publisher Site | Google Scholar
  3. D. J. Marchant, J. H. Boyd, D. C. Lin, D. J. Granville, F. S. Garmaroudi, and B. M. McManus, “Inflammation in myocardial diseases,” Circulation Research, vol. 110, no. 1, pp. 126–144, 2012. View at: Publisher Site | Google Scholar
  4. G. Wei, Y. Guan, Y. Yin et al., “Anti-inflammatory effect of protocatechuic aldehyde on myocardial ischemia/reperfusion injury in vivo and in vitro,” Inflammation, vol. 36, no. 3, pp. 592–602, 2013. View at: Publisher Site | Google Scholar
  5. N. Frangogiannis, C. W. Smith, and M. L. Entman, “The inflammatory response in myocardial infarction,” Cardiovascular Research, vol. 53, no. 1, pp. 31–47, 2002. View at: Publisher Site | Google Scholar
  6. E. van Rooij, “Introduction to the series on microRNAs in the cardiovascular system,” Circulation Research, vol. 110, no. 3, pp. 481-482, 2012. View at: Publisher Site | Google Scholar
  7. D. P. Bartel, “MicroRNAs,” Cell, vol. 116, no. 2, pp. 281–297, 2004. View at: Publisher Site | Google Scholar
  8. S. Bagga, J. Bracht, S. Hunter et al., “Regulation by let-7 and lin-4 miRNAs results in target mRNA degradation,” Cell, vol. 122, no. 4, pp. 553–563, 2005. View at: Publisher Site | Google Scholar
  9. B. P. Lewis, C. B. Burge, and D. P. Bartel, “Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets,” Cell, vol. 120, no. 1, pp. 15–20, 2005. View at: Publisher Site | Google Scholar
  10. S. Gilad, E. Meiri, Y. Yogev et al., “Serum microRNAs are promising novel biomarkers,” PLoS One, vol. 3, no. 9, Article ID e3148, 2008. View at: Publisher Site | Google Scholar
  11. P. S. Mitchell, R. K. Parkin, E. M. Kroh et al., “Circulating microRNAs as stable blood-based markers for cancer detection,” Proceedings of the National Academy of Sciences, vol. 105, no. 30, pp. 10513–10518, 2008. View at: Publisher Site | Google Scholar
  12. A. Caroli, M. T. Cardillo, R. Galea, and L. M. Biasucci, “Potential therapeutic role of microRNAs in ischemic heart disease,” Journal of Cardiology, vol. 61, no. 5, pp. 315–320, 2013. View at: Publisher Site | Google Scholar
  13. M. V. G. Latronico and G. Condorelli, “Therapeutic use of microRNAs in myocardial diseases,” Current Heart Failure Reports, vol. 8, no. 3, pp. 193–197, 2011. View at: Publisher Site | Google Scholar
  14. M. V. G. Latronico and G. Condorelli, “MicroRNAs in hypertrophy and heart failure,” Experimental Biology and Medicine, vol. 236, no. 2, pp. 125–131, 2011. View at: Publisher Site | Google Scholar
  15. S. J. Matkovich, W. Wang, Y. Tu et al., “MicroRNA-133a protects against myocardial fibrosis and modulates electrical repolarization without affecting hypertrophy in pressure-overloaded adult hearts,” Circulation Research, vol. 106, no. 1, pp. 166–175, 2010. View at: Publisher Site | Google Scholar
  16. D. Sayed, C. Hong, I.-Y. Chen, J. Lypowy, and M. Abdellatif, “MicroRNAs play an essential role in the development of cardiac hypertrophy,” Circulation Research, vol. 100, no. 3, pp. 416–424, 2007. View at: Publisher Site | Google Scholar
  17. V. Divakaran and D. L. Mann, “The emerging role of microRNAs in cardiac remodeling and heart failure,” Circulation Research, vol. 103, no. 10, pp. 1072–1083, 2008. View at: Publisher Site | Google Scholar
  18. T. Thum, P. Galuppo, C. Wolf et al., “MicroRNAs in the human heart,” Circulation, vol. 116, no. 3, pp. 258–267, 2007. View at: Publisher Site | Google Scholar
  19. E. van Rooij, L. B. Sutherland, N. Liu et al., “A signature pattern of stress-responsive microRNAs that can evoke cardiac hypertrophy and heart failure,” Proceedings of the National Academy of Sciences, vol. 103, no. 48, pp. 18255–18260, 2006. View at: Publisher Site | Google Scholar
  20. A. J. Tijsen, E. E. Creemers, P. D. Moerland et al., “MiR423-5p as a circulating biomarker for heart failure,” Circulation Research, vol. 106, no. 6, pp. 1035–1039, 2010. View at: Publisher Site | Google Scholar
  21. T. B. Huffaker, R. Hu, M. C. Runtsch et al., “Epistasis between microRNAs 155 and 146a during T cell-mediated antitumor immunity,” Cell Reports, vol. 2, no. 6, pp. 1697–1709, 2012. View at: Publisher Site | Google Scholar
  22. A. Li, J. Li, Y. Bao, D. Yuan, and Z. Huang, “Xuebijing injection alleviates cytokine-induced inflammatory liver injury in CLP-induced septic rats through induction of suppressor of cytokine signaling 1,” Experimental and Therapeutic Medicine, vol. 12, no. 3, pp. 1531–1536, 2016. View at: Publisher Site | Google Scholar
  23. M.-W. Liu, R. Liu, H.-Y. Wu et al., “Protective effect of Xuebijing injection on D-galactosamine- and lipopolysaccharide-induced acute liver injury in rats through the regulation of p38 MAPK, MMP-9 and HO-1 expression by increasing TIPE2 expression,” International Journal of Molecular Medicine, vol. 38, no. 5, pp. 1419–1432, 2016. View at: Publisher Site | Google Scholar
  24. P. Huang, B. Lv, X. Jiang et al., “Identification of NF-κB inhibitors following Shenfu injection and bioactivity-integrated UPLC/Q-TOF-MS and screening for related anti-inflammatory targets in vitro and in silico,” Journal of Ethnopharmacology, vol. 194, pp. 658–667, 2016. View at: Publisher Site | Google Scholar
  25. Y. Guan, Y. Yin, Y. R. Zhu et al., “Dissection of mechanisms of a Chinese medicinal formula: Danhong injection therapy for myocardial ischemia/reperfusion injury in vivo and in vitro,” Evidence-Based Complementary and Alternative Medicine, vol. 2013, Article ID 972370, 12 pages, 2013. View at: Publisher Site | Google Scholar
  26. M. Sun, J.-J. Zhang, J.-Z. Shan et al., “Clinical observation of Danhong injection (herbal TCM product from Radix Salviae miltiorrhizae and Flos Carthami tinctorii) in the treatment of traumatic intracranial hematoma,” Phytomedicine, vol. 16, no. 8, pp. 683–689, 2009. View at: Publisher Site | Google Scholar
  27. H.-T. Liu, Y.-F. Wang, O. Olaleye et al., “Characterization of in vivo antioxidant constituents and dual-standard quality assessment of Danhong injection,” Biomedical Chromatography, vol. 27, no. 5, pp. 655–663, 2013. View at: Publisher Site | Google Scholar
  28. L.-N. Gao, Y.-L. Cui, Q.-S. Wang, and S.-X. Wang, “Amelioration of Danhong injection on the lipopolysaccharide-stimulated systemic acute inflammatory reaction via multi-target strategy,” Journal of Ethnopharmacology, vol. 149, no. 3, pp. 772–782, 2013. View at: Publisher Site | Google Scholar
  29. J. Chen, W. Cao, P. F. Asare et al., “Amelioration of cardiac dysfunction and ventricular remodeling after myocardial infarction by Danhong injection are critically contributed by anti-TGF-β-mediated fibrosis and angiogenesis mechanisms,” Journal of Ethnopharmacology, vol. 194, pp. 559–570, 2016. View at: Publisher Site | Google Scholar
  30. J. Wan, H. Wan, R. Yang et al., “Protective effect of Danhong injection combined with Naoxintong capsule on cerebral ischemia-reperfusion injury in rats,” Journal of Ethnopharmacology, vol. 211, pp. 348–357, 2018. View at: Publisher Site | Google Scholar
  31. H.-P. Mao, X.-Y. Wang, Y. H. Gao et al., “Danhong injection attenuates isoproterenol-induced cardiac hypertrophy by regulating p38 and NF-κb pathway,” Journal of Ethnopharmacology, vol. 186, pp. 20–29, 2016. View at: Publisher Site | Google Scholar
  32. M. A. Pfeffer, J. M. Pfeffer, M. C. Fishbein et al., “Myocardial infarct size and ventricular function in rats,” Circulation Research, vol. 44, no. 4, pp. 503–512, 1979. View at: Publisher Site | Google Scholar
  33. K. Jujo, M. Ii, H. Sekiguchi et al., “CXC-chemokine receptor 4 antagonist AMD3100 promotes cardiac functional recovery after ischemia/reperfusion injury via endothelial nitric oxide synthase-dependent mechanism,” Circulation, vol. 127, no. 1, pp. 63–73, 2013. View at: Publisher Site | Google Scholar
  34. J. Takagawa, Y. Zhang, M. L. Wong et al., “Myocardial infarct size measurement in the mouse chronic infarction model: comparison of area- and length-based approaches,” Journal of Applied Physiology, vol. 102, no. 6, pp. 2104–2111, 2007. View at: Publisher Site | Google Scholar
  35. Y. Bi, G. Liu, and R. Yang, “MicroRNAs: novel regulators during the immune response,” Journal of Cellular Physiology, vol. 218, no. 3, pp. 467–472, 2009. View at: Publisher Site | Google Scholar
  36. R. Y. Cao, Q. Li, Y. Miao et al., “The emerging role of microRNA-155 in cardiovascular diseases,” BioMed Research International, vol. 2016, Article ID 9869208, 5 pages, 2016. View at: Publisher Site | Google Scholar
  37. E. M. Small, R. J. A. Frost, and E. N. Olson, “MicroRNAs add a new dimension to cardiovascular disease,” Circulation, vol. 121, no. 8, pp. 1022–1032, 2010. View at: Publisher Site | Google Scholar
  38. G. Liu, A. Friggeri, Y. Yang, Y.-J. Park, Y. Tsuruta, and E. Abraham, “miR-147, a microRNA that is induced upon toll-like receptor stimulation, regulates murine macrophage inflammatory responses,” Proceedings of the National Academy of Sciences, vol. 106, no. 37, pp. 15819–15824, 2009. View at: Publisher Site | Google Scholar
  39. G. Condorelli, R. Roncarati, J. Ross et al., “Heart-targeted over expression of caspase 3 in mice increases infarct size and depresses cardiac function,” Proceedings of the National Academy of Sciences, vol. 98, no. 17, pp. 9977–9982, 2001. View at: Publisher Site | Google Scholar
  40. M. Frati and K. Nishida, “Oxidative stress and left ventricular remodelling after myocardial infarction,” Cardiovascular Research, vol. 81, no. 3, pp. 457–464, 2009. View at: Publisher Site | Google Scholar
  41. M. Agosto, M. Azrin, K. Singh, A. S. Jaffe, and B. T. Liang, “Serum caspase-3 p17 fragment is elevated in patients with ST-segment elevation myocardial infarction,” Journal of the American College of Cardiology, vol. 57, no. 2, pp. 220-221, 2011. View at: Publisher Site | Google Scholar
  42. A. J. Asirvatham, W. J. Magner, and T. B. Tomasi, “MiRNA regulation of cytokine genes,” Cytokine, vol. 45, no. 2, pp. 58–69, 2009. View at: Publisher Site | Google Scholar
  43. E. Brennan, B. Wang, A. McClelland et al., “Protective effect of let-7 miRNA family in regulating inflammation in diabetes-associated atherosclerosis,” Diabetes, vol. 66, no. 8, pp. 2266–2277, 2017. View at: Publisher Site | Google Scholar
  44. S. D. Prabhu and N. G. Frangogiannis, “The biological basis for cardiac repair after myocardial infarction,” Circulation Research, vol. 119, no. 1, pp. 91–112, 2016. View at: Publisher Site | Google Scholar
  45. S. T. Smale, “Dimer-specific regulatory mechanisms within the NF-κB family of transcription factors,” Immunological Reviews, vol. 246, no. 1, pp. 193–204, 2012. View at: Publisher Site | Google Scholar
  46. S. J. Crampton and G. W. O’Keeffe, “NF-κB: emerging roles in hippocampal development and function,” The International Journal of Biochemistry & Cell Biology, vol. 45, no. 8, pp. 1821–1824, 2013. View at: Publisher Site | Google Scholar
  47. B. Kaltschmidt and C. Kaltschmidt, “NF- B in the nervous system,” Cold Spring Harbor Perspectives in Biology, vol. 1, no. 3, Article ID a001271, 2009. View at: Publisher Site | Google Scholar

Copyright © 2019 Jingrui Chen et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


More related articles

505 Views | 350 Downloads | 0 Citations
 PDF  Download Citation  Citation
 Download other formatsMore
 Order printed copiesOrder

Related articles

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.