Evidence-Based Complementary and Alternative Medicine / 2019 / Article / Tab 1

Research Article

Oxidative Stress and TGF-β1/Smads Signaling Are Involved in Rosa roxburghii Fruit Extract Alleviating Renal Fibrosis

Table 1

Primers for quantitative RT-PCR.

GenePrimerSequence (5′->3′)Size (bp)

GAPDHForwardCATGAGAAGTATGACAACAGCCT113
ReverseAGTCCTTCCACGATACCAAAGT
SMAD2ForwardGCCGCCCGAAGGGTAGAT164
ReverseTTCTGTTCTCCACCACCTGC
SMAD7ForwardGGTGCGTGGTGGCATACT144
ReverseGCTGACTCTTGTTGTCCGAAT
TGFBR1ForwardGCAATGGGCTTAGTATTCTGG76
ReverseAAGGCAACTGGTAGTCTTCGTG
TGFBR2ForwardTGTGGAGGAAGAACGACAAGA78
ReverseGAGTGAAGCCGTGGTAGGTG
TGFB1ForwardCATGGAGCTGGTGAAACGGAAG74
ReverseGACTGGCGAGCCTTAGTTTGGAC
SMAD3ForwardCGATGTCCCCAGCACACAATAAC82
ReverseTAGTAGGAGATGGAGCACCAAAAGG

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.