Evidence-Based Complementary and Alternative Medicine / 2019 / Article / Tab 1

Research Article

Anti‐Aging Effects of Schisandrae chinensis Fructus Extract: Improvement of Insulin Sensitivity and Muscle Function in Aged Mice

Table 1

Primer sets used for quantitative PCR analyses.

No.PrimerSenseAntisense

1MuRF-1AGGACTCCTGCAGAGTGACCAATTCTCGTCCAGGATGGCGTA
2Atrogin-1GCAAACACTGCCACATTCTCTCCTTGAGGGGAAAGTGAGACG
3MyostatinGGCCATGATCTTGCTGTAACTTGGGTGCGATAATCCAGTC
418S rRNACCATCCAATCGGTAGTAGCGGTAACCCGTTGAACCCCATT
5MyoGCCAACCCAGGAGATCATTTGACGATGGACGTAAGGGAGTG
6MRF4GGCCAAGTGTTTCGGATCATTAAGAAAGGCGCTGAAGACTGC
7MyHC 1CCAAGGGCCTGAATGAGGAGGCAAAGGCTCCAGGTCTGAG
8MyHC 2AAAGCGAAGAGTAAGGCTGTCGTGATTGCTTGCAAAGGAAC
9MyHC 2BACAAGCTGCGGGTGAAGAGCCAGGACAGTGACAAAGAACG
10MyHC 2XCACCGTCTGGATGAGGCTGATGTTTGCGCAGACCCTTGATAG