Evidence-Based Complementary and Alternative Medicine

Evidence-Based Complementary and Alternative Medicine / 2019 / Article

Research Article | Open Access

Volume 2019 |Article ID 6709278 | 16 pages | https://doi.org/10.1155/2019/6709278

Bufei Qingyu Granules Inhibit the Development of Systemic Sclerosis via Notch-1/Jagged-2 Signaling Pathway

Academic Editor: Yuewen Gong
Received07 Jan 2019
Revised20 Mar 2019
Accepted27 Mar 2019
Published02 Jul 2019

Abstract

Systemic sclerosis (SSc) is a rare chronic autoimmune disorder, mainly characterized by skin sclerosis. In this study, Bufei Qingyu Granules (BQG), a Chinese herbal formula, was used to treat SSc. To better understand the effects and molecular mechanisms of BQG, we successfully established a Bleomycin- (BLM-) induced SSc mouse model, and the mice were treated by BQG. Meanwhile, transcriptomic and bioinformatics analyses were conducted on those samples. As a result, we visually showed that BQG ameliorated the overall health of mice, including body weight, spleen, and thymus index. Thus, it also significantly alleviated inflammation presented by Chemokine (C-X-C motif) ligand 2 (Cxcl2), vasculopathy characterized by α-smooth muscle actin (α-SMA), and fibrotic changes elaborated by not only pathological images, but also the hydroxyproline (HYP) content. After testing by transcriptomic analysis, Cxcl2, Synaptosomal-associated protein 25 (Snap25), and Eukaryotic translation initiation factor 3, and subunit J2 (Eif3j2) which were differentially expressed genes, were verified, so that the data were credible. We further found that BQG could regulate Notch signaling pathway by significantly decreasing both mRNA and protein expression levels of Notch-1 and Jagged-2. Hence, this study demonstrated that BQG could ameliorate the sclerotic skin in mice model involved in inflammation, vascular changes, and fibrosis effects, which was partly mediated by Notch signaling pathway.

1. Introduction

Systemic sclerosis (SSc) is a rare chronic autoimmune rheumatic disease characterized by persistent extensive fibroproliferation of skin and multiple visceral organs [1]. According to the severity and the involved area, the localized scleroderma should be differentiated from the limited cutaneous scleroderma [2]. Although pathogenesis and the underlying molecular mechanism should be fully elucidated, there is no doubt that this can be attributed to three backbones as follows: innate immune, vasculopathy, and fibrosis [35].

Although treatment of SSc has greatly attracted the scholar’ attention, there is currently no curative therapy resistant to the mentioned disorder [6]. In Chinese medicine, as supplement of modern medicine, there is a treasure, which need to be exploited, especially for this complex disease [79]. Bufei Qingyu Granules (BQG), that is a traditional Chinese medicine (TCM), is composed of Astragalus mongholicus (Huangqi), Salvia miltiorrhiza (Danshen), Angelica sinensis (Danggui), and other seven Chinese herbs on the basis of a certain proportion of composition. Astragalus mongholicus and Angelica sinensis mixture may have antifibrotic effects on renal tubulointerstitial fibrosis and nephrotic syndrome [10, 11]. Compound Astragalus and Salvia miltiorrhiza extractions would be also beneficial for fibrotic diseases, such as liver fibrosis and hypertrophic scar [1214]. BQG has been developed and extensively used by Jiangsu Province Hospital of TCM (Nanjing, China) for the treatment of SSc and a portion of pulmonary fibrosis, demonstrating to be highly beneficial in clinical practice. In a preliminary evidence, we previously found the utility of alleviating sclerotic skin with appropriate dosage of BQG in Bleomycin- (BLM-) induced mice model [15].

In recent years, transcriptomics and bioinformatics analyses, providing important lines for understanding of genes’ regulations and the mechanisms behind them, were extensively applied in TCM-based researches [16, 17]. Here, in order to deeply explore the treatment efficacy of BQG, we obtained a relatively reliable material and sample basis, and the high-throughput sequencing and bioinformatics approaches were subsequently carried out to find out differentially expressed genes (DEGs) and analyze the effects of BQG at both gene and protein expression levels. In addition, we aimed to reveal the potential targets and signaling pathways associated with the treatment efficacy of BQG for SSc.

2. Materials and Methods

2.1. Ethics Statement

All animal experiments were strictly performed in accordance with the “Guide for the Care and Use of Laboratory Animals” published by the National Institutes of Health (NIH; Bethesda, MD, USA). This study was reviewed and approved by the Ethics Committee of Nanjing Medical University (Nanjing, China).

2.2. Preparation of BQG Samples

A total of 10 individual BQG components were commercially available in form of solid granules provided by JiangYin TianJiang Pharmaceuticals Co. Ltd. (Jiangsu, China), which were packaged in 0.5-3 g per bag for each herb. The detailed information of each herb granule was presented in Table 1. Based on our preexperiments, all the herb granules were dissolved in distilled water as solvent to make 1.736 g/mL BQG by an ultrasonic bath for 1 h and then stored at 4°C. In addition, BQG was fully oscillated and mixed before treating mice.


Chinese nameHerb (Local name)Medicinal partsAmount (g)Batch number

HangQiAstragalus membranaceus (Fisch.) Bge.var. mongholicus (Bge.) HsiaoRoot30 g1705165
DangShenCodonopsis pilosula (Franch.) Nannf.Root20 g1706201
ShanYaoDioscorea opposita Thunb.rhizome20 g1705108
DanPiPaeonia suffruticosaAndr.root bark12 g17121101
DanShenSalvia miltiorrhiza Bge.Root20 g1706030
DangGuiAngelica sinensis (oliv.)Diels.Root10 g1707182
TaoRenPrunus persica(L) Batch.Seed10 g17121371
WuWeiziSchisandra chinensis(Turcz.) Baill.Fruit6 g1706066
LingXiaoHuaCampsis grandiflora (Thunb.) K. Schum.Flower10 g1609126
JieGengPlatycodon grandiforum(Jacq) A. DC.Root6 g18011431

BQG was quantitated and mixed with double volume of pure methanol, and then the solution was under vortex for 1 min and centrifuged at 12,000 rpm for 10 min at 4°C. The supernatant was filtered through a membrane filter (0.45 μm). Gradient dilution of the filtrate was conducted with 50% methanol before ultra-high-performance liquid chromatography combined with quadrupole-time-of-flight mass spectrometry (UHPLC-Q-TOF/MS) analysis.

2.3. UHPLC-Q-TOF/MS Analysis

This analysis was carried out by using an Agilent 1290 Infinity LC system (Agilent Technologies, Santa Clara, CA, USA) in combination with a Triple TOF 5600 system equipped with an electrospray ionization (ESI) source (AB SCIEX, Framingham, MA, USA). An XTerra® MS C18 column (2.1 mm × 100 mm, 3.5 μm) was used for the purpose of chromatographic separation and its temperature was maintained at 40°C during the analysis. The mobile phase was composed of 0.1% aqueous formic acid (A) and acetonitrile (B). The gradient elution program could be used for treatment with 5% B for 0-2 min, with 5%-90% B for 2-9 min, and with 90% B for 9-11 min, and posttreatment for 12-14 min. The flow rate was 200 μL/min and the injection volume was 10 μL. Positive and negative ion modes were operated, respectively, for the analysis. An ESI source was applied with parameters as follows: Ion Spray voltage, 4500 V; ion source gas 1 (N2), 50 Arb; ion source gas 2 (N2), 50 Arb; gas temperature, 550°C; curtain gas, 35 Arb; declustering potential, 80 V. The mass spectrum was acquired from 60 to 1500 m/z, and the collision energy was 10 eV.

2.4. Mice

Female BALB/c mice with the age of 6-week-old were purchased from the Experimental Animal Center of Nantong University (Nantong, China) and were maintained in specific pathogen-free mouse colonies with a 12 h light cycle and temperature varying between 25 and 28°C. Relative humidity was maintained between 50% and 60%. Before the start of study, all the mice were acclimated to laboratory conditions for within one week. Then, all the mice were randomly divided into three groups as follows: control group (n=6); BLM group (n=6); BLM + 34.72 g/kg BQG treatment group (n=6, dosage was selected according to a previous study [15]).

2.5. Mouse Model of SSc and BQG Treatment

Here, BLM (Hisun-Pfizer Pharmaceuticals Co. Ltd., China) was dissolved in phosphate-buffered saline (PBS) at the concentration of 400 μg/mL and sterilized by filtration as well. Mice underwent a subcutaneous and daily injection of 100 μL BLM or PBS solution into a single location on the shaved backs of mice with a 0.45 mm needle. The injection was carried out successively for 4 weeks as previously described [18]. Drug intervention was started during BLM or PBS subcutaneous injection. In the case of BLM exposure model, mice were treated with 0.2 mL/10 g BQG via oral gavage. In addition to BLM group and control group, normal vehicle (PBS) was administered with an equal volume in the same manner.

Mice were weighted and sacrificed 24 h after the last dosage. Some organs and the shaved back of skins were resected for further studies after quick freezing in liquid nitrogen, which were then preserved at -80°C.

2.6. Overall Health Assessment

Before mice to be sacrificed, the condition of mice and their skin were daily observed. Body weight (g) of mice was measured and noted weekly. After mice were sacrificed, the lung, spleen, and thymus were taken out and index of organs was calculated in each group of mice according to the following formula: index of organ = weight of organ (mg) / body weight (g) 100%.

2.7. Histopathological Examination

All skin sections were cut from the paramidline, lower back shaved region. The skin pieces which were fixed in 4% paraformaldehyde for 24 h were embedded in paraffin routinely. A 5 μm-thick tissue section was stained with hematoxylin and eosin (H&E) and Masson’s trichrome stain. We evaluated dermal thickness, which was defined as the thickness of skin from the dermal-epidermal junction to the junction between the dermis and subcutaneous fat [19, 20]. The thickness of dermis was calculated from six different randomly selected fields per specimen by using Image J software (NIH, Bethesda, MD, USA). Slides were examined by standard bright-field microscopy (Nikon Ni-U, China) by two pathologists who were single blinded to the experimental group assignment.

2.8. Determination of Hydroxyproline Content in Skin Tissue

Hydroxyproline (HYP) assay was used to measure collagen contents. Following manufacturer’s instructions of HYP-detection kits (Nanjing Jiancheng Biological Engineering Research Institute, Nanjing, China), 6 mm punch biopsy specimens of shaved back skin tissues were hydrolyzed. The supernatants were collected after chain reaction, and the HYP content was quantified by colorimetric analysis at 550 nm (Synergy HT Microplate Reader; BioTek Instruments, Inc., Winooski, VT, USA) in mice of each group.

2.9. Enzyme-Linked Immunosorbent Assay (ELISA)

Chemokine (C-X-C motif) ligand 2 (Cxcl2) levels in mice serum were collected by cardiac puncture before to be sacrificed and were assessed using ELISA kits (Nanjing Jin Yibai Biological Technology, Nanjing, China) in accordance with the manufacturers’ instructions. The final results were presented in histogram.

2.10. Immunostaining

Immunohistochemistry was carried out using antibodies directed against α-smooth muscle actin (Proteintech, Rosemont, IL, USA) abiding by the routine protocols as previously described [21]. Then, all slices were examined independently by two investigators in a blinded manner.

2.11. Total RNA Extraction

Total RNA isolation from skin tissues was executed respectively by using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA) in each group according to the manufacturer’s introductions. The quantity and purity of RNA were measured by using Qubit 2.0 Fluorometer (Thermo Fisher Scientific, Waltham, MA, USA); thus, RNA integrity was verified by agarose gel.

2.12. Transcriptomic Assay and Bioinformatics Analysis

High-quality RNA was used for library construction and high-throughput sequencing. RNA sequencing library was carried out using the VAHTSTM mRNA-seq V2 Library prep Kit (Illumina, Chicago, IL, USA) according to the manufacturer’s protocols. The library was then sequenced on a Hiseq platform (Illumina, Chicago, IL, USA) by Sangon Biotech Co., Ltd. (Shanghai, China).

Transcriptome analysis was undertaken using mice’s reference genome-based reads mapping. Gene expression levels were estimated using Transcripts Per Million (TPM) values. High-throughput sequencing was performed through applying the criteria of log2 fold change>1, P-values<0.05, and at least one group’s mean TPM≥5 as DEGs, which was employed for subsequent analysis.

2.13. Quantitative Reverse Transcription Polymerase Chain Reaction (RT-qPCR)

The process of RNA extraction was carried out as mentioned previously. Here, 1 μg of total mRNA was reverse-transcribed into cDNA synthesized with HiScript® II One Step RT-qPCR Probe Kit (Illumina, Chicago, IL, USA). Target genes were analyzed by RT-qPCR according to the manufacturer’s instructions (Applied Biosystems Inc., Foster City, CA, USA). The associated primer sequences are listed in Table 2. The relative mRNA expression levels were quantified with the method and the amplified transcript level of each specific gene was normalized to the expression of the endogenous control GAPDH.


TargetsForward primer (5’-3’)Reverse primer (3’-5’)

Mus-Cxcl2CCAACCACCAGGCTACAGGGCGTCACACTCAAGCTCTG
Mus-Snap25GCTGGAGGAGATGCAGAGGATCCAGTTGTTCGCCTTGCTC
Mus-Eif3j2ACCAACTCATTGACTGTGCTCTGCCCACCATAATCTGCCAGGTCGTC
Mus-Notch1ATGCTGCTGTTGTGCTCCTGAAGCGGCAATCGGTCCATGTGATCC
Mus-Jagged2AAGGAGTACCAGGCCAAGGTGACCCGGCGGCAGGTAGAAGGAG
Mus-GAPDHCACCATCTTCCAGGAGCGAGCCTTCTCCATGGTGGTGAAGAC

2.14. Antibodies and Western Blot Analysis

The radio immunoprecipitation assay (RIPA) lysis buffer (Solarbio, Beijing, China) was added into skin tissues, while the tube was placed on ice for 40 min. The tissue was then centrifuged at 12000 rpm for 5 min at 4°C to remove pellet. The lysate, which was transferred to a fresh tube, was measured by using BCA Protein Assay kit (Thermo Fisher Scientific, Waltham, MA, USA). Add 5 × SDS stop buffer to the lysate so as to reach 1 × SDS final. Load denatured mixture of protein and protein markers into the gel and transfer onto Polyvinylidene difluoride (PVDF) membranes. After electrotransferring and blocking with 1 × TBST containing 5% nonfat dry milk, membranes were incubated with primary antibodies overnight at 4°C: mouse monoclonal GAPDH (1:10000; Proteintech, Rosemont, IL, USA), rabbit monoclonal Anti-Jagged2 (1:500; Abcam, Cambridge, UK), and Notch1 XP®rabbit mAb (1:500, Cell Signaling Technology, Danvers, MA, USA). Then, the membranes were incubated with the horseradish peroxidase- (HRP-) conjugated secondary antibody diluted at 1:2000 (Proteintech, Rosemont, IL, USA) at room temperature for 1 h. Last but not least is the exposure under a chemiluminescence imaging system (Bio-Rad Laboratories, Hercules, CA, USA). GAPDH was used as a loading control. All the protein bands were analyzed by using Image J software.

2.15. Statistical Analysis

The data were presented as mean ± standard deviation (SD). Data analysis was performed by using GraphPad Prism 6 software, version 6.0a (GraphPad Software, USA). Averaged data of two groups were compared using unpaired two-sample t-test. One-way analysis of variance (ANOVA) with Bonferroni adjustment were used to perform multiple group comparisons. A P-value<0.05 was considered statistically significant.

3. Results

3.1. Typical Chemical Components and Their Contents in BQG Are Identified by UHPLC-Q-TOF/MS

To clarify the material basis of BQG for the treatment efficacy, the representative chemical components in BQG confirmed by UHPLC-Q-TOF/MS were detected under the optimized conditions. As data are shown in Figures 1(a) and 1(b) and Table 3, a total of 14 peak signals and the content of each constituent were identified and calculated, respectively.


PeakIdentificationContent (ug/g)Source

1Amygdalin2023.5TaoRen
2Paeonol764.5DanPi
3Schisandrol A38.7WuWeiZi
4Dihydrotanshinone I9.3DanShen
5Cryptotanshinone11.5DanShen
6Schizandrin A0.7WuWeiZi
7Tanshinone IIA9.9DanShen
8Schizandrin B0.7WuWeiZi
9Danshensu2290.2DanShen
10Acteoside549.3LingXiaoHua
11Ferulic acid45.2DangGui
12Lobetyolin31.0DangShen
13Platycodin D76.2JieGeng
14Astragaloside IV196.0HangQi

3.2. Effects of BQG Are Showed in Overall Health of Mice

In this experiment, the overall health of mice was observed as a routine. The conditions of mice in the control group treated with PBS, which included the spirit, food intake, activity, and body weight, were much better than the BLM group at the end of the point, and also the hair in shaved area was almost recovered. Compared with the model group, the status of BQG-treated mice exceeded; thus, the degree of dermal sclerosis was lighter, not as the hair around the injection site stopping growing. There was no significant difference in body weight of mice between each group before the start of the experiment (P=0.056). The mice in model group had the lowest body weight among the three groups. BQG-treated group had the higher body weight compared with the model group (19.4983 ± 0.83968 g vs 17.7833 ± 0.94534 g, P=0.004; Figure 2(a)). The organ index, including lung, spleen, and thymus, was used to reflect the status of the animal’s function in a chronic drug experiment, especially for the thymus and spleen as important indicator reflecting the immune function and splenomegaly occurrence of the body to some extent. As illustrated in Figure 2(b), there was no significant difference in lung index between the groups, P>0.05. There was apparently lower level of spleen index in BQG-treated group compared with the model group (P<0.001). However, the level of thymus index obviously increased compared with the model group (P<0.001).

3.3. BQG Attenuates Skin Sclerosis in BLM-Induced Animal Model

In this section, our eyes were fixed to indicate whether BQG has the valid effects on BLM-induced mice model. To the end, lesional skin sites were thicker in BLM-induced mice than in PBS-treated mice on 28th day, and no effects were observed on the shaved skin of PBS-treated mice. However, dermal thickness was visualized to be obviously decreased by BQG intervention in both slices stained by H&E and Masson’s trichrome (Figures 3(a) and 3(b)). Moreover, histogram was used to quantify dermal thickness and levels of HYP content in each group of mice, which showed that both of two items were significantly reduced in BLM exposure mice treated with BQG compared with those which did not receive BQG (Figures 3(c) and 3(d)).

In addition, α-smooth muscle actin (α-SMA) expression was evaluated by immunohistochemistry, which showed that proliferation of positive vascular smooth muscle cells visualized as like vessel wall thickness was decreased in BQG group, compared with the BLM group mice (Figure 4). Besides, inflammation involved in this progress was detected by the production levels of Cxcl2. As shown in Figure 5, BQG group cut the expression by almost half percent compared with BLM model group.

Taken together, these results indicated that BQG had a potential inhibition role in inflammation, vascular changes, and fibrosis in the BLM-induced SSc mouse model.

3.4. DEGs Are Expressed between BLM Model and BQG-Treated Group

A comparative analysis between the control, BLM, and BQG-treated groups for transcriptome analysis and gene expression was conducted. In total, the RNA-Seq results included within 51826 genes. As displayed in Figure 6(a), both up- and downregulated DEGs were overlapped. Of these, transcriptomic analysis revealed that, compared with the control group, 1502 genes were upregulated in the BLM model group, among which 945 genes were changed in the BQG-treated group. In addition, 618 genes were downregulated in the BLM model group, among which 103 genes were reversed in the BQG-treated group. From Figures 6(b) and 6(c), the condition of DEGs, especially between the BLM model and BQG treatment groups, could be observed. By the way, the pathologic changes of sample 3 were not as severe as that another two. Maybe this is the reason why sample 3 of BLM group is a little bit different from another two in heat map. Relatively small sample size may also be a factor to lead to this phenomenon. Thus, adding sample 3 will not significantly improve the original results. The top 10 up- and downregulated DEGs were ranked after intervention of BQG compared with BLM model group, respectively (see Tables 4 and 5).


Gene IDGene Namelog2 fold changeP-value

ENSMUSG00000097656Gm267127.986593141.31E-06
ENSMUSG00000105338Gm438027.803599753.28E-08
ENSMUSG00000106587AC125099.27.4700518923.57E-06
ENSMUSG00000103308Gm378004.0236286924.11E-05
ENSMUSG00000049421Zfp2603.6895708869.22E-06
ENSMUSG00000003545Fosb3.687903893.35E-06
ENSMUSG00000057465Saa23.5727744372.45E-06
ENSMUSG00000079025Gsdmc3.3555152548.02E-06
ENSMUSG00000043424Eif3j23.1020513282.66E-07
ENSMUSG00000046311Zfp622.1355491651.47E-06


Gene IDGene Namelog2 fold changeP-value

ENSMUSG00000027273Snap25-6.267291.36E-05
ENSMUSG00000084257Gm11597-6.267028.33E-05
ENSMUSG00000083405Gm15725-5.904416.95E-07
ENSMUSG00000102564Gm37035-5.41236.22E-08
ENSMUSG00000058427Cxcl2-5.303874.51E-06
ENSMUSG00000097724Gm26850-5.069651.66E-05
ENSMUSG00000099068Gm27861-4.830044.91E-05
ENSMUSG00000029379Cxcl3-4.544728.15E-05
ENSMUSG00000097078Gm26566-4.258599.63E-05
ENSMUSG00000103309BC037039-4.224223.50E-05

3.5. Notch Signaling Serves as a Candidate Pathway in Regulating SSc

In order to further discover the potential functional pathways variated by BQG, we carried out Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis for DEGs, and the top 10 DEGs are listed in Table 6. Notch signaling pathway ranking 5 was priorly chosen to be verified in the following experiments (Figure 7). To explore the biological function of differentially expressed mRNA, Gene Ontology (GO) pathway annotation was conducted. It was revealed that, under the undistinguished circumstance of up- or downregulated relationship, single-organism cellular process was the most significantly enriched pathway for biological processes, compared with the BLM model group. In addition to the analysis of molecular function enrichment, the DEGs were enriched in protein binding. Moreover, intracellular part was the most obvious pathway of cellular component, which had the enriched DEG called Notch-1. Both up- and downregulated mRNAs significantly enriched GO terms, and the top 20 DEGs are presented in Table 7.


IDDescriptionP-valueSignificant symbol genes

UP-REGULATED

ko03010Ribosome0.001525Rpl30, Rpl26, Rpl35a, Rpl31, Rps27a, Rpl27-ps3
ko04924Renin secretion0.002328Calm4, Gucy1a3, Adcyap1r1, Gucy1b3
ko03030DNA replication0.004173Rnaseh2b, Rpa3, Mcm6
ko04624Toll and Imd signaling pathway0.004522Birc3, Tab2, Faf1
ko04713Circadian entrainment0.008117Calm4, Gucy1a3, Adcyap1r1, Gucy1b3
ko05031Amphetamine addiction0.018481Calm4, Fosb, Ppp1cb
ko00230Purine metabolism0.018499Nt5e, Entpd5, Gucy1a3, Gucy1b3, Pde4d
ko04970Salivary secretion0.020157Calm4, Gucy1a3, Gucy1b3
ko04611Platelet activation0.022505Gucy1a3, Vamp8, Ppp1cb, Gucy1b3
ko04270Vascular smooth muscle contraction0.023148Calm4, Gucy1a3, Ppp1cb, Gucy1b3

DOWN-REGULATED

ko04550Signaling pathways regulating pluripotency of stem cells0.001454Inhbb, Wnt4, Map2k2, Dvl1, Mapk13, Id1, Fgfr3, Axin2, Tcf3, Myf5, Wnt9a, Fzd8, Fzd2, Dlx5, Wnt3a, Fgfr4
ko04360Axon guidance0.002752Wnt4, Sema3f, Sema4g, Efnb1, Plxna3, Ssh3, Epha2, Pak6, Abl1, Pak4, Ephb3, Plxnb1, Efna2, Fes, Nck2, Ephb6, Sema4f, Sema4b
ko04115p53 signaling pathway0.002898Sfn, Gtse1, Gadd45g, Gadd45a, Rprm, Gadd45b, Pidd1, Sesn2, Bbc3, Bax
ko04390Hippo signaling pathway0.003971Wnt4, Dvl1, Llgl2, Id1, Axin2, Llgl1, Wnt9a, Fzd8, Fzd2, Wwc1, Scrib, Tead3, Ajuba, Wnt3a, Bbc3, Smad7
ko04330Notch signaling pathway0.006239Dvl1, Hes1, Dtx2, Lfng, Jag2, Notch1, Ncor2
ko05166HTLV-I infection0.006668Wnt4, Dvl1, Cdc20, Ranbp3, Ranbp1, Crtc1, Map3k14, Tcf3, Pold1, H2-Q2, Wnt9a, Msx1, Bcl2l1, Fzd8, Fzd2, Cdkn2b, H2-Q6, Ltbr, Wnt3a, Pdgfa, Slc2a1, Mybl2, Bax, Fosl1
ko04014Ras signaling pathway0.010254Ngfr, Map2k2, Pla2g6, Rgl2, Arf6, Gnb2, Fgfr3, Rin1, Epha2, Pak6, Abl1, Pak4, Rasal3, Pla2g4f, Efna2, Bcl2l1, Zap70, Pdgfa, Fgfr4, Rasal1
ko05322Systemic lupus erythematosus0.012114Hist1h2bl, Hist3h2a, Hist1h2br, Hist1h4n, Hist1h4m, H2afz, Hist1h3d, H2afj, Hist1h4k, Hist2h3c2, Hist1h3i, Hist1h2bg, Hist1h2bk, H2afx
ko00680Methane metabolism0.012152Shmt2, Eno1b, Pfkl, Phgdh, Eno1
ko05230Central carbon metabolism in cancer0.014355Slc16a3, Map2k2, Fgfr3, Hk3, Pfkl, Sirt6, Erbb2, Slc2a1


OntologyIDTermGene countP-value

UP-REGULATED

biological processGO: 0008152metabolic process1194.60E-07
GO: 0044237cellular metabolic process1074.20E-06
GO: 0044238primary metabolic process1086.30E-06
GO: 0071704organic substance metabolic process1116.90E-06
molecular functionGO: 0003735structural constituent of ribosome115.00E-07
GO: 0035662Toll-like receptor 4 binding35.10E-06
cellular componentGO: 0044445cytosolic part121.20E-06
GO: 0022626cytosolic ribosome91.60E-06
GO: 0022625cytosolic large ribosomal subunit74.10E-06
GO: 0044391ribosomal subunit109.50E-06
GO: 0005840ribosome111.30E-05
GO: 0005683U7 snRNP32.90E-05
GO: 0005687U4 snRNP38.40E-05
GO: 0005615extracellular space290.00012
GO: 0015934large ribosomal subunit70.00014
GO: 0005576extracellular region580.00016
GO: 0032991macromolecular complex610.00016
GO: 0034709methylosome30.00018
GO: 0044421extracellular region part520.00023
GO: 0034719SMN-Sm protein complex30.00033

DOWN-REGULATED

cellular componentGO: 0044424intracellular part8393.60E-30
GO: 0005622intracellular8581.50E-27
GO: 0043229intracellular organelle7376.00E-22
GO: 0043226organelle7871.90E-21
GO: 0005737cytoplasm6601.30E-19
GO: 0043227membrane-bounded organelle7247.80E-18
GO: 0044446intracellular organelle part5111.30E-15
GO: 0043231intracellular membrane-bounded organelle6302.10E-15
GO: 0044422organelle part5195.80E-15
molecular functionGO: 0005515protein binding5679.00E-22
biological processGO: 0044763single-organism cellular process6412.60E-18
GO: 0007275multicellular organism development3642.70E-17
GO: 0048731system development3335.90E-17
GO: 0009888tissue development1662.00E-16
GO: 0048518positive regulation of biological process3792.50E-15
GO: 0048513animal organ development2603.70E-15
GO: 0048856anatomical structure development3833.90E-15
GO: 0043588skin development484.90E-15
GO: 0044707single-multicellular organism process4075.00E-15
GO: 0032502developmental process4071.10E-14

3.6. Notch-1 and Jagged-2 Play The Important Roles in The Pathological Progress of SSc

Based on the above mentioned results, overlapped DEGs were identified as potential targets and further confirmed by RT-qPCR as well. In the results, the trends of Cxcl2, Synaptosomal-associated protein 25 (Snap25), Eukaryotic translation initiation factor 3, subunit J2 (Eif3j2), Notch-1, and Jagged-2 were illustrated in Figures 8(a)8(e); thus, there was a statistical significance at the transcript expression level between the groups. In addition, Western blot analysis was carried out using the same remaining samples. It is noteworthy that Notch-1 and Jagged-2 (Figures 9(a)9(c)) were significantly elevated in the BLM model group compared with the control group at the protein expression level. On the contrary, the decrease of the expression level of Notch-1 and Jagged-2 was detected in BQG-treated group. As a result, Notch signaling pathway was associated with proteins named Notch-1 and Jagged-2, which participated in the construction of SSc model and the treatment process of BQG.

4. Discussion

The purpose of our present study was to achieve the BQG’s molecular evidence against dermal sclerosis out of mess and to provide a new evidence for network pharmacology. We showed the representative constitutes and the contents of BQG, and the BQG’s preventive effects on SSc were revealed as well. Furthermore, 5 potential targets were sought out and validated in 1048 genes altered after BQG treatment. Thus, the possible mechanism was verified, which inhibited the Notch signaling pathway.

BQG, consisting of ten Chinese herbs, is mainly used for treating the SSc’s “Lung deficiency generating phlegm stasis” syndrome. In addition, some evidences about its effects associated with fibrosis, which is the footstone of SSc, could be found in previous studies. Danshensu, one of the major components derived from Salvia miltiorrhiza Bunge, can attenuate cardiac fibrosis and hepatic fibrosis [22, 23]. Amygdalin can reduce the BLM-induced increase of proteinic biomarkers in rat serum [24]. It also can attenuate kidney fibroblast activation and rat renal interstitial fibrosis [25]. Paeonol has therapeutic functions on BLM-induced pulmonary fibrosis in mice and, at least in part, could be mediated by the inhibition of the MAPKs/Smad3 signaling pathway [26]. As the main active substance of Astragalus membranaceus Bunge, astragaloside IV also contains the potent protective effect on cardiovascular disease, pulmonary disease, and liver fibrosis [27]. Because BQG is a material basis for the treatment efficacy, the main focus in the next step will be to identify and separate precise active ingredients.

However, the effect of compound drugs cannot be replaced by a single component. To uncover the possible mechanism by a holistic approach, the BLM-induced SSc mouse model was previously tested successfully, which was consistent with our present in vivo study. Over time, BQG ameliorated the overall health of mice, including body weight. Thus, BQG-treated group attenuated the level of spleen index and increased thymus index conversely to a certain extent, indicating that BQG could prevent the occurrence of splenomegaly and play a protective role in immune system. Additionally, BQG administration stopped the tendency of skin sclerosis development reflected by not only pathological images, but also the HYP content. Cxcl2 is a chemokine primarily functions with recruiting neutrophils [28, 29]. Besides, we found that its expression level increased in model group, which was in agreement with the findings of a previous research [30]. BQG also significantly reduced Cxcl2 level, indicating that BQG alleviated inflammation partly due to Cxcl2 or the involvement of neutrophils. Vasculopathy characterized by α-SMA plays an important role in the pathogenesis of SSc [31, 32]. BQG was showed to be advantageous to improve the expression level of α-SMA-positive cells in vascular walls, and it was revealed that BQG’s effect might be possibly related to vascular changes. Previous evidences supported this consequence as well [21, 31]. All these efforts provided a reliable sample basis for subsequent analysis. Additionally, we for the first time illustrated the underlying mechanisms of this old traditional formula using transcriptomics and bioinformatics analyses to examine the possible molecular targets affected by BQG. RNA-sequency expression profiling showed that 945 genes were altered after BQG administration. Three predicted target genes were selected for validation by RT-qPCR, whose fold-change tendencies of Cxcl2, Snap25, and Eif3j2 were consistent with transcriptomic data. These results consolidated that RNA-sequencing data were credible. Then, DEGs were analyzed by protein-protein interaction (PPI) network and Notch-1/Jagged-2 signaling was sort out. Furthermore, we confirmed them in gene level by RT-qPCR, and their associated proteins were validated by Western blotting as well.

Notch signaling pathway ranked 5 in our data, and that is a conserved developmental pathway, participating in regulating all kinds of key cellular processes [33], as well as acting in the SSc pathogenesis. Clara et al. demonstrated that Notch signaling can be highly activated in SSc, and it also can promote collagen release and activation of fibroblast isolated from the skin samples. Additionally, fibrosis could be ameliorated by inhibition of Notch signaling pathway, applying a γ-secretase inhibitor (DAPT) or overexpression of a Notch-1 antisense construct [34, 35], which was in agreement with Kavian et al.’s findings [36]. It was reported that Notch deficiency resulted in a crucial inhibitory effect on the response to BLM-induced dermal fibrosis and lung fibrosis [37]. To our knowledge, core elements of this signaling pathway consists of four Notch transmembrane receptors and five transmembrane ligands in mammals named as follows: Notch 1-4, three Delta-like proteins (DLL1, DLL3, and DLL4), and two Jagged proteins (Jag 1, 2). However, the detailed contribution of the diverse Notch receptors has remained obscure, especially in terms of occurring in a variety of circumstances. Two-step proteolysis of the receptors was caused by binding and interaction between Notch receptors and their ligands. Then, an active form of the Notch intracellular domain (NICD) was released and translocated from cytoplasm to nucleus, where it ultimately interacted with transcriptional repressors, stimulating the expression level of various genes [3840]. Several tissues express not only Jagged-2, but also Notch-1 because Notch-1 is a cognate receptor for Jagged-2 [41]. To date, there is no enough evidence on how Notch signaling pathway stimulates collagen release in fibrotic diseases on a molecular level. Here, as schematic diagram shown in Figure 10, we only provided a novel evidence that Notch-1 and Jagged-2 were also elevated in the BLM-induced SSc mouse model. Moreover, depending on BQG that repressed the expression level of Notch-1 and Jagged-2, it is suggested that the reduction of progress in skin sclerosis may be mediated by inhibition of the activation of Notch signaling pathway. Consequently, it could enhance the current understanding of Notch signal transduction in BLM-induced SSc mouse model, although it was not fully elucidated whether BQG acted directly or indirectly.

Nevertheless, some limitations of our study should be pointed out. Firstly, the presented Chinese medicinal formula is pretty complex, especially in the efficacy and mechanism of chemical components which needs to be further explored with more samples size. Secondly, as different mice models have different clinical features and molecular bases, more various mice models should be used to evaluate the effects of BQG on SSc treatment to further support our findings. Thirdly, a small part of target genes was confirmed in this experiment; the rest latently should be under consideration for the sake of moving as far as possible to “Precision Medicine” in Chinese herbs.

5. Conclusion

The results showed that the administration of BQG can prevent sclerotic skin induced by BLM in mice model, and this process is partly associated with decrease of inflammation, vascular changes, and fibrosis effects, so as to suppress the production of fibrillar collagens, which are modulated by blocking Notch signaling pathway.

Abbreviations

BLM:Bleomycin
BQG:Bufei Qingyu Granule
Cxcl2:Chemokine (C-X-C motif) ligand 2
DEGs:Differentially expressed genes
Eif3j2:Eukaryotic translation initiation factor 3, subunit J2
ELISA:Enzyme-Linked Immunosorbent Assay
ESI:Electrospray ionization
GO:Gene Ontology
H&E:Hematoxylin and eosin
HYP:Hydroxyproline
KEGG:Kyoto Encyclopedia of Genes and Genomes
NICD:Notch intracellular domain
PBS:Phosphate buffered saline
PVDF:Polyvinylidene difluoride
RIPA:Radio immunoprecipitation assay
SD:Standard deviation
Snap25:Synaptosomal-associated protein 25
SSc:Systemic sclerosis
TCM:Traditional Chinese medicine
TPM:Transcripts Per Million
UHPLC-Q-TOF/MS:Ultraperformance liquid chromatography coupled with quadrupole-time-of-flight mass spectrometry
α-SMA:-smooth muscle actin.

Data Availability

The data used to support the findings of this study are available from the corresponding author upon request.

Conflicts of Interest

All of the authors declare no conflicts of interest.

Authors’ Contributions

Minhui Su and Fang Tian equally contributed to this study.

Acknowledgments

This research was funded by the National Natural Science Foundation of China (Grant no. 81273714). Experimental facilities were provided by Department of Center Laboratory in Jiangsu Province Hospital of Traditional Chinese Medicine. This work must acknowledge the kind assistance received from Biqing Chen, Zhihui Liu, Fei Ke, Min Wu, Jianyu Sun, etc.

References

  1. A. J. Affandi, T. R. D. J. Radstake, and W. Marut, “Update on biomarkers in systemic sclerosis: tools for diagnosis and treatment,” Seminars in Immunopathology, vol. 37, no. 5, pp. 475–487, 2015. View at: Publisher Site | Google Scholar
  2. C. P. Denton and D. Khanna, “Systemic sclerosis,” The Lancet, vol. 390, no. 10103, pp. 1685–1699, 2017. View at: Publisher Site | Google Scholar
  3. S. Bhattacharyya, J. Wei, W. G. Tourtellotte, M. Hinchcliff, C. G. Gottardi, and J. Varga, “Fibrosis in systemic sclerosis: common and unique pathobiology,” Fibrogenesis & Tissue Repair, vol. 5, p. S18, 2012. View at: Publisher Site | Google Scholar
  4. T. Taniguchi, Y. Asano, K. Akamata et al., “Fibrosis, vascular activation, and immune abnormalities resembling systemic sclerosis in bleomycin-treated Fli-1-haploinsufficient mice,” Arthritis & Rheumatology, vol. 67, no. 2, pp. 517–526, 2015. View at: Publisher Site | Google Scholar
  5. C. Dowson, N. Simpson, L. Duffy, and S. O’Reilly, “Innate immunity in systemic sclerosis,” Current Rheumatology Reports, vol. 19, no. 2, 2017. View at: Google Scholar
  6. J. H. W. Distler, C. Feghali-Bostwick, A. Soare, Y. Asano, O. Distler, and D. J. Abraham, “Review: frontiers of antifibrotic therapy in systemic sclerosis,” Arthritis & Rheumatology, vol. 69, no. 2, pp. 257–267, 2017. View at: Google Scholar
  7. P. P. Huang, S. G. Wang, and G. X. Hua, “Observation on blood flow changes in 34 cases of progressive systemic scleroderma treated with Chinese herbal medicine,” Chinese Journal of Integrated Traditional and Western Medicine, vol. 14, no. 2, pp. 86–68, 1994. View at: Google Scholar
  8. T. Wu, H. Chu, W. Tu et al., “Dissection of the mechanism of traditional Chinese medical prescription-Yiqihuoxue formula as an effective anti-fibrotic treatment for systemic sclerosis,” BMC Complementary and Alternative Medicine, vol. 14, no. 224, 2014. View at: Google Scholar
  9. L. Han, H. Bian, J. Ouyang, Y. Bi, L. Yang, and S. Ye, “Wenyang Huazhuo Tongluo formula, a Chinese herbal decoction, improves skin fibrosis by promoting apoptosis and inhibiting proliferation through down-regulation of survivin and cyclin D1 in systemic sclerosis,” BMC Complementary and Alternative Medicine, vol. 16, no. 69, 2016. View at: Google Scholar
  10. J.-R. Zhao, L. Qu, and X.-M. Li, “Preventive and therapeutic effects of astragalus and angelica mixture on renal tubulointerstitial fibrosis after unilateral ureteral obstruction in rats,” Journal of Peking University Health sciences, vol. 36, no. 2, pp. 119–123, 2004. View at: Google Scholar
  11. H. Wang, J. Li, L. Yu, Y. Zhao, and W. Ding, “Antifibrotic effect of the Chinese herbs, Astragalus mongholicus and Angelica sinensis, in a rat model of chronic puromycin aminonucleoside nephrosis,” Life Sciences, vol. 74, no. 13, pp. 1645–1658, 2004. View at: Publisher Site | Google Scholar
  12. S. He, Y. Yang, X. Liu et al., “Compound Astragalus and Salvia miltiorrhiza extract inhibits cell proliferation, invasion and collagen synthesis in keloid fibroblasts by mediating transforming growth factor-β/Smad pathway,” British Journal of Dermatology, vol. 166, no. 3, pp. 564–574, 2012. View at: Publisher Site | Google Scholar
  13. Y. Yang, S. Yang, M. Chen, X. Zhang, Y. Zou, and X. Zhang, “Compound astragalus and salvia miltiorrhiza extract exerts anti-fibrosis by mediating TGF-β/Smad signaling in myofibroblasts,” Journal of Ethnopharmacology, vol. 118, no. 2, pp. 264–270, 2008. View at: Publisher Site | Google Scholar
  14. C. Wu, J. Jiang, A. Boye, Y. Jiang, and Y. Yang, “Compound astragalus and salvia miltiorrhiza extract suppresses rabbits' hypertrophic scar by modulating the TGF-β/smad signal,” Dermatology, vol. 229, no. 4, pp. 363–368, 2014. View at: Publisher Site | Google Scholar
  15. X. Qian, X.-X. Zhu, and X.-Y. Chen, “Effect of Bufei Qingyu Granule in mollifying skin of mouse scleroderma model,” Chinese Journal of Integrated Traditional and Western Medicine, vol. 26, no. 11, pp. 1018–1020, 2006. View at: Google Scholar
  16. L. Jiang, X. Li, Y. Zhang, M. Zhang, Z. Tang, and K. Lv, “Microarray and bioinformatics analyses of gene expression profiles in BALB/c murine macrophage polarization,” Molecular Medicine Reports, vol. 16, no. 5, pp. 7382–7390, 2017. View at: Publisher Site | Google Scholar
  17. H. Wang, W. Xing, S. Tang et al., “Du formula alleviates diabetic retinopathy in rats by inhibiting SOCS3-STAT3 and TIMP1-A2M pathways,” International Journal of Genomics, vol. 2017, Article ID 4832125, 2017. View at: Google Scholar
  18. J. Avouac, “Mouse model of experimental dermal fibrosis: The bleomycin-induced dermal fibrosis,” Methods in Molecular Biology, vol. 1142, pp. 91–98, 2014. View at: Publisher Site | Google Scholar
  19. T. Yamashita, Y. Asano, T. Taniguchi et al., “Glycyrrhizin ameliorates fibrosis, vasculopathy, and inflammation in animal models of systemic sclerosis,” Journal of Investigative Dermatology, vol. 137, no. 3, pp. 631–640, 2017. View at: Publisher Site | Google Scholar
  20. F. Morin, N. Kavian, S. Chouzenoux et al., “Leflunomide prevents ROS-induced systemic fibrosis in mice,” Free Radical Biology & Medicine, vol. 108, pp. 192–203, 2017. View at: Publisher Site | Google Scholar
  21. Q. Qi, Y. Mao, Y. Tian et al., “Geniposide inhibited endothelial-mesenchymal transition via the mTOR signaling pathway in a bleomycin-induced scleroderma mouse model,” American Journal of Translational Research, vol. 9, no. 3, pp. 1025–1036, 2017. View at: Google Scholar
  22. H. Lu, A. Tian, J. Wu, C. Yang, R. Xing, and P. Jia, “Danshensu inhibits beta-adrenergic receptors-mediated cardiac fibrosis by ROS/p38 MAPK axis,” Biological & Pharmaceutical Bulletin, vol. 37, pp. 961–967, 2014. View at: Google Scholar
  23. W. Qu, H. Huang, K. Li, and C. Qin, “Danshensu-mediated protective effect against hepatic fibrosis induced by carbon tetrachloride in rats,” Pathologie Biologie, vol. 62, no. 6, pp. 348–353, 2014. View at: Publisher Site | Google Scholar
  24. H.-K. Du, F.-C. Song, X. Zhou, H. Li, and J.-P. Zhang, “Effect of amygdalin on serum proteinic biomarker in pulmonary fibrosis of bleomycin-induced rat,” Chinese Journal of Industrial Hygiene And Occupational Diseases, vol. 28, no. 4, pp. 260–263, 2010. View at: Google Scholar
  25. J. Guo, W. Wu, M. Sheng, S. Yang, and J. Tan, “Amygdalin inhibits renal fibrosis in chronic kidney disease,” Molecular Medicine Reports, vol. 7, no. 5, pp. 1453–1457, 2013. View at: Publisher Site | Google Scholar
  26. M.-H. Liu, A.-H. Lin, H.-K. Ko, D.-W. Perng, T.-S. Lee, and Y. R. Kou, “Prevention of bleomycin-induced pulmonary inflammation and fibrosis in mice by paeonol,” Frontiers in Physiology, vol. 8, p. 193, 2017. View at: Google Scholar
  27. L. Li, X. Hou, R. Xu, C. Liu, and M. Tu, “Research review on the pharmacological effects of astragaloside IV,” Fundamental & Clinical Pharmacology, vol. 31, pp. 17–36, 2017. View at: Google Scholar
  28. V. Marcos, Z. Zhou, A. Ö. Yildirim et al., “CXCR2 mediates NADPH oxidase-independent neutrophil extracellular trap formation in cystic fibrosis airway inflammation,” Nature Medicine, vol. 16, no. 7, pp. 1018–1023, 2011. View at: Google Scholar
  29. K. De Filippo, A. Dudeck, M. Hasenberg et al., “Mast cell and macrophage chemokines CXCL1/CXCL2 control the early stage of neutrophil recruitment during tissue inflammation,” Blood, vol. 121, no. 24, pp. 4930–4937, 2013. View at: Publisher Site | Google Scholar
  30. M. Liang, J. Lv, L. Zou et al., “A modified murine model of systemic sclerosis: Bleomycin given by pump infusion induced skin and pulmonary inflammation and fibrosis,” Laboratory Investigation, vol. 95, no. 3, pp. 342–350, 2015. View at: Publisher Site | Google Scholar
  31. T. Yamamoto and I. Katayama, “Vascular changes in bleomycin-induced scleroderma,” International Journal of Rheumatology, vol. 2011, 2011. View at: Google Scholar
  32. M. Trojanowska, “Cellular and molecular aspects of vascular dysfunction in systemic sclerosis,” Nature Reviews Rheumatology, vol. 6, no. 8, pp. 453–460, 2010. View at: Publisher Site | Google Scholar
  33. A. Sasnauskiene, V. Jonusiene, A. Krikstaponiene et al., “NOTCH1, NOTCH3, NOTCH4, and JAG2 protein levels in human endometrial cancer,” Medicina (Lithuania), vol. 50, no. 1, pp. 14–18, 2014. View at: Google Scholar
  34. C. Dees, P. Zerr, M. Tomcik et al., “Inhibition of Notch signaling prevents experimental fibrosis and induces regression of established fibrosis,” Arthritis & Rheumatology, vol. 63, no. 5, pp. 1396–1404, 2011. View at: Publisher Site | Google Scholar
  35. C. Dees, M. Tomcik, P. Zerr et al., “Notch signalling regulates fibroblast activation and collagen release in systemic sclerosis,” Annals of the Rheumatic Diseases, vol. 70, no. 7, pp. 1304–1310, 2011. View at: Publisher Site | Google Scholar
  36. N. Kavian, A. Servettaz, C. Mongaret et al., “Targeting ADAM-17/notch signaling abrogates the development of systemic sclerosis in a murine model,” Arthritis & Rheumatology, vol. 62, no. 11, pp. 3477–3487, 2010. View at: Publisher Site | Google Scholar
  37. Y. Liu, G. Huang, B. Mo, and C. Wang, “Artesunate ameliorates lung fibrosis via inhibiting the notch signaling pathway,” Experimental and Therapeutic Medicine, vol. 14, no. 1, pp. 561–566, 2017. View at: Publisher Site | Google Scholar
  38. D. Zong, R. Ouyang, J. Li, Y. Chen, and P. Chen, “Notch signaling in lung diseases: Focus on Notch1 and Notch3,” Therapeutic Advances in Respiratory Disease, vol. 10, no. 5, pp. 468–484, 2016. View at: Publisher Site | Google Scholar
  39. B. Hu and S. H. Phan, “Notch in fibrosis and as a target of anti-fibrotic therapy,” Pharmacological Research, vol. 108, pp. 57–64, 2016. View at: Publisher Site | Google Scholar
  40. D.-H. Nam, H.-M. Jeon, S. Kim et al., “Activation of Notch signaling in a xenograft model of brain metastasis,” Clinical Cancer Research, vol. 14, no. 13, pp. 4059–4066, 2008. View at: Publisher Site | Google Scholar
  41. B. Luo, J. C. Aster, R. P. Hasserjian, F. Kuo, and J. Sklar, “Isolation and functional analysis of a cDNA for human Jagged2, a gene encoding a ligand for the Notch1 receptor,” Molecular and Cellular Biology, vol. 17, no. 10, pp. 6057–6067, 1997. View at: Publisher Site | Google Scholar

Copyright © 2019 Minhui Su et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


More related articles

711 Views | 239 Downloads | 0 Citations
 PDF  Download Citation  Citation
 Download other formatsMore
 Order printed copiesOrder

Related articles

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.