Evidence-Based Complementary and Alternative Medicine

Evidence-Based Complementary and Alternative Medicine / 2019 / Article

Research Article | Open Access

Volume 2019 |Article ID 7312842 | 7 pages | https://doi.org/10.1155/2019/7312842

Antidepressant Effect of Tetragonia tetragonoides (Pall.) Kuntze Extract on Serotonin Turnover

Academic Editor: Sokcheon Pak
Received20 Aug 2018
Revised21 Dec 2018
Accepted08 Jan 2019
Published03 Feb 2019

Abstract

Tetragonia tetragonoides (Pall.) Kuntze (TTK) is a groundcover found along coastal areas of the Korean peninsula. TTK is traditionally used to improve women’s health and treat gastrointestinal diseases. Use of herbal medicines in the treatment of mood disorders has recently been suggested as an alternative therapeutic strategy. In the present study, we determined that consumption of TTK extract ameliorated progression of depressive-like symptoms in ovariectomized (OVX) rats and further examined the mechanisms involved, i.e., synthesis, release, and reuptake(s) of serotonin (also known as 5-HT). We assessed the mRNA expression levels of tryptophan hydroxylases (TPH-1 and TPH-2) and serotonin transporter (SERT) as well as the reuptake activity of serotonin in RBL-2H3 cells. We also determined whether or not TTK extract regulates the serum level of serotonin and improves depressive-like symptoms in 0.5, 1, and 2% TTK-fed OVX female rats in a forced swimming test. Our results show that the mRNA levels of TPH-1 and SERT were significantly reduced, whereas the mRNA level of TPH-2 was dose-dependently elevated by TTK (50 and 100 μg/mL) in RBL-2H3 cells. TTK significantly inhibited LPS- (lipopolysaccharide-) induced serotonin uptake in RBL-2H3 cells in a dose-dependent manner. The serum level(s) of serotonin was elevated by 1% and 2% TTK treatment in OVX female rats. Moreover, immobility time in the forced swimming test was reduced by 1% and 2% TTK treatment but not altered by 0.5% TTK treatment in OVX female rats. Taken together, these results indicate that TTK may significantly inhibit depressive-like symptoms due to upregulation of serotonin level(s) and regulation of serotonin reuptake activity. Thus, TTK may exert beneficial effects on depression during pre- or/and postmenopausal periods via modulation of serotonin synthesis and metabolism.

1. Introduction

Depression is a psychiatric disease as well as a chronic, recurring, and potentially life-threatening illness. The main symptoms of depression are characterized by a mood imbalance, loss of interest, and unhappiness [1]. The symptoms of depression during menopause are similar to general depression, although menopausal depression is highly affected by hormone fluctuation [2, 3]. Hormonal fluctuations such as elevation of follicle-stimulating hormone and reduction of ovarian hormone levels, i.e., estrogen and progesterone, are a common phenomenon during menopause [4].

Tetragonia tetragonoides (Pall.) Kuntze (TTK), known in Korea as Beonhaengcho, has similar textures and flavor properties as spinach. TTK therapy has been shown to alleviate menopausal symptoms and treat hepatic cell metabolism [57]. In a recent report, various herbal extracts improved menopausal symptoms such as hot flashes, weight gain, and involutional depression [810]. Hypericum perforatum, Rhodiola rosea, and Crocus sativus have also been used as alternative therapeutics for the treatment of general depressive symptoms, inhibition of monoamine reuptake, and sensitization of neurotransmitter receptors [1113].

Serotonin or 5-hydroxytryptamine (5-HT), a monoamine neurotransmitter, plays a critical role in the pathophysiology of mood disorders, i.e., anxiety disorder and depression [14, 15]. Serotonin controls central nervous system (CNS) function, including sleep, endocrine secretion, motor function, and cognition [16, 17]. Many antidepressant drugs target the release of serotonin and its transport system, including serotonin transporter (SERT) and inhibition of serotonin reuptake activity [18]. Selective serotonin reuptake inhibitor (SSRI) is used for treatment of depression, bone loss, and peripheral errors in postmenopausal women [19, 20]. The serotonergic systems and reproductive endocrinology have been linked in various reports, which are markedly related in mood change and behavior patterns [21, 22]. Fluoxetine is the only SSRI registered for the treatment of depression in postmenopausal women in the Unites States [23]. In addition, molecular imaging studies have observed reduction of brain SERT binding in major depressive disorders. Translational level of SERT might affect SSRI efficacy either directly or through adaptive changes in serotonergic function [24, 25].

Tryptophan hydroxylase (TPH) belongs to the enzyme superfamily of aromatic amino acid hydroxylases and is the regulator of serotonin synthesis and serotonin activity in the brain [26, 27]. There are two isoforms of TPH (TPH-1 and TPH-2), which mediate the synthesis of most peripheral serotonin and are predominantly expressed in the gut, thymus, spleen, and pineal gland [28, 29]. Especially, TPH-2 is a neuronal-specific enzyme that is predominantly expressed in the neurons of raphe nuclei in the brain stem, and it is the rate-limiting enzyme in serotonin synthesis as well as a key factor for serotonin transmission in the CNS [30, 31]. Recent studies have assessed the recurrence of patients suffering from depression, and targeting of TPH-2 was shown to improve the effectiveness of antidepressant medications [32, 33].

As mentioned before, we hypothesized that TTK might be effective in improving menopausal depression, which is known to have various pharmacological effects on improving the symptoms of menopausal symptoms, antiobesity, and hepatocyte apoptosis induction. In the present study, we examined the therapeutic effect of TTK on serotonergic system through the expression of TPHs, SERT and 5-HT reuptake activity in in vitro model. We also used ovariectomized (OVX) rats to investigate whether or not TTK can elevate serum levels of serotonin and improve immobility time in an in vivo model.

2. Materials and Methods

2.1. Preparation of TTK Extract

TTK was purchased from a commercial vender at Kwangmyung-Dang (Ulsan, South Korea). All raw materials and extracts were deposited at the Korea Institute of Oriental Medicine (KIOM 130081-3). Dried TTK (4 kg) was and extracted with 40 L of 70% ethanol for 3 days at 25-30°C. The 70% ethanol extracts were concentrated using a rotary evaporator and finally lyophilized in a freeze-dryer. Yield of TTK crude extract was 992.6 g (22.43% w/w).

2.2. Cell Lines and Cell Culture

The rat basophilic leukemia cell line RBL-2H3 was purchased from the ATCC (American Type Culture Collection). RBL-2H3 cells were maintained in Minimum Essential Medium (MEM) α containing 10% fetal bovine serum, 100 U/mL of penicillin, and 100 mg/mL of streptomycin in a humidified atmosphere containing 5% CO2 at 37°C.

2.3. Reagents and Antibodies

ASP (4-Di-1-ASP (4-(4-(Dimethylamino)styryl)-N-Methylpyridinium Iodide)) was obtained from Invitrogen (Carlsbad, CA, USA). LPS (Lipopolysaccharide) and Fluoxetine were purchased from Sigma-Aldrich (St Louis, MO, USA). Stock solutions were prepared in dimethyl sulfoxide (DMSO) and stored at -20°C. ASP and LPS were diluted in fresh medium before each experiment, and the final concentration of DMSO was <0.1%.

2.4. Reverse Transcription and Real-Time PCR

Total RNA was extracted using RNeasy Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions. cDNA was synthesized using 1 μg of total RNA with a Thermo Scientific RevertAid First Strand cDNA Synthesis Kit (Thermo, Massachusetts, USA) and amplified by RT-PCR using AmpliTaq Gold DNA polymerase and Quantitative real-time PCR. cDNA was amplified using Premix ExTaq (TaKaRa Bio Inc., Shiga, Japan) with SYBR Premix EX Taq (TaKaRa Bio Inc.) using the BI PRISM 7500HT Sequence Detection System (Applied Biosystems, USA). Primer was synthesized by Macrogen Inc. (Seoul, South Korea). Actin expression was used as a control, and the primers used for RT-PCR are listed in Table 1.


No.GeneForward Primer (5′ to 3′)Reverse Primer (5′ to 3′)Annealing  
Temperature (°C)
Product Size (bp)

1TPH-1ACCATCTTC CGAGAGCTGAAGATGGAAAACCCTGTGCGTT58°C162
2TPH-2ATCCCAAGTTTGCTCAGTTTTGATGGACGAAAGTAACCCTG58°C167
3SERTAACTGGCAGAAACTCTTGGAGAAGATGACGAA GCCAGAGA58°C195
4ActinTACGTCGCCCTGGATTTTATGAAAGAGGGCTGGAAGAG60°C149

2.5. Cell Growth Inhibition Assay

Cell viability was assessed using MTT assays. A total of 1x103 cells/mL were seeded in 96-well plates, incubated for 16 h, and treated for 72 h with TTK at 37°C. After treatment, medium was replaced with an equal volume of fresh medium containing 2 mg/mL of 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl-tetrazolium bromide (MTT, Sigma-Aldrich, St Louis, MO, USA) diluted in PBS and incubated for 4 h at 37°C, after which the medium was discarded. After confirming formation of formazan, medium was completely removed and analyzed by adding 150 μL of DMSO to melt the formazan. Cell viability was determined by measuring absorbance at 540 nm using an ELISA microplate reader (Synergy HTX Multi- Mode Reader; BioTeK, Winooski, VT, USA).

2.6. 5-HT Uptake Assay

5-HT transport activity into RBL-2H3 cells was assessed by ASP assay. Briefly, RBL-2H3 cells were harvested at approximately 60-80% confluence and seeded in 24-well plates at a density of 5x105 cells/well in 500 μL of nucleoside-free MEM α containing 10% fetal bovine serum. Cells were untreated or treated with TTK at different concentrations (50 or 100 μg/mL). After 16 h, medium was replaced with serum-free medium, followed by incubation for 4 h at 37°C. Cells were then washed with PBS buffer three times, incubated with medium containing 1 mM ASP, and dissolved in DMSO at 37°C for 1 h in the dark. Next, ASP-containing medium was removed, and cells were washed three times with PBS. Fluorescence density was measured using a multifluorescent microplate reader (Spectra-Max Paradigm Multi-Mode Microplate Reader; Molecular devices, Sunnyvale, California, USA) at λex=475 nm and λem=605 nm.

2.7. Experimental Animals and Treatments

Female Sprague-Dawley rats (6-weeks-old, weight 130-150 g, total n=32, n=8 per group) were purchased from Orient Bio Inc. (Seongnam, South Korea) and allowed to adapt to laboratory conditions (temperature: 20 ± 2°C, relative humidity: 45 ± 5%, light/dark cycle: 12 h) for 1 week. Rats were anesthetized with an intraperitoneal (i.p.) injection of a Zoletil-Rompun-saline mixture (2:1:2). The dorsal midline of rats was incised, and the fallopian tube ligated. The ovaries were dissected using a surgical scissor, and the skin incision was sutured by surgical silk (6-0). The ovariectomized rats were fed AIN-76A-modified diet (37 En% carbohydrate, 20 En% protein, and 43 En% fat) as a vehicle control and supplemented with 0.5% (TTK0.5; w/w), 1% (TTK1.0; w/w), and 2% (TTK2.0; w/w) TTK for 8 weeks (from 8 to 16 weeks of age). Body weight (BW) and daily food intake were measured prior to and following the experimental feeding period. All animal experimental procedures were approved by the Ethics Committee of Veterinary Medicine of Chungnam University (Daejeon, South Korea).

2.8. Serum Serotonin Analysis

Blood samples were collected directly from the inferior vena cava using a 1-mL syringe at the end of the experiment. Serum was obtained by centrifugation at 4,000 x g for 10 min and stored at -70°C until use. Serum serotonin levels were measured using a Serotonin ELISA kit (Abnova; Taipei, Taiwan) according to the manufacturer’s instructions.

2.9. Forced Swimming Test

Rats were subjected to a forced swimming test, and this method involves the rats becoming passive and immobile after a period of vigorous activity. The test apparatus was a polycarbonate cylinder (diameter: 300 mm, depth: 400 mm) filled with room temperature water. The rats were exposed to a pretest for 10 min prior to the experiment. Immobility was defined as no additional activity other than that necessary to keep the rat’s head above the water.

2.10. Statistical Analysis

Data is presented as means ± SD. Paired Student’s t-tests were used to compare each group or ANOVA with Tukey for multiple comparison tests using PRISM software (v6.0; Graph Pad, CA, USA). P values < 0.05 were considered to be statistically significant.

3. Results

3.1. Cytotoxicity Effect of TTK on RBL-2H3

RBL-2H3 cells were treated with various concentrations of TTK for 72 h. Upon treatment with 10-1000 μg/mL of TTK, viability rate of cells treated with 500 μg/mL of TTK was approximately 80% compared to that of nontreatment. Based on the data, a subsequent experiment was conducted using a concentration of TTK below 500 μg/mL (Figure 1).

3.2. Effects of TTK on TPH-1, TPH-2, and SERT mRNA Expression

The effects of TTK on mRNA expression levels of TPH-1, TPH-2, and SERT, which are associated with serotonin synthesis and uptake, were assessed. Especially, TPH-2 is expressed in peripheral tissues of the brain, which is important in the regulation of mood disorders, whereas TPH-1 is not significantly expressed in the brain [34]. We demonstrated that treatment of RBL-2H3 cells with 50 and 100 μg/mL of TTK significantly increased TPH-2 mRNA expression. On the contrary, TPH-1 and SERT expression decreased upon TTK treatment (Figure 2).

3.3. Effects of TTK on 5-HT Uptake by RBL-2H3 Cells

To further explore the effects of TTK on 5-HT uptake by RBL-2H3 cells, 5-HT uptake was analyzed by measuring SERT activities based on ASP fluorescent intensities in RBL-2H3 cells. LPS is known to enhance 5-HT uptake by stimulating SERT, which plays a critical role in depression [34], whereas Fluoxetine is known to reduce 5-HT uptake by acting as an SSRI. The results show that 5-HT uptake significantly decreased upon TTK treatment in a dose-dependent manner similar to the effect of 10 μM Fluoxetine (Figure 3).

3.4. Serum Serotonin Level and Immobility Time

Dietary supplementation with TTK extract affected serum levels of serotonin in rats. As shown in Figure 4, serum serotonin levels were significantly elevated by supplementation with 1% or 2% TTK extract compared to the vehicle group. However, serum levels of serotonin were not altered in the 0.5% TTK-treated group. The effect of TTK on immobility time in rats is shown in Figure 5. The doses of TTK extract (1% and 2%) significantly reduced the duration of immobility in comparison with vehicle control, but its effect was not shown in 0.5% TTK-treated group. The maximal antidepressant effects of TTK extract were obtained with 1% TTK diet, and there were no significant differences between 1% and 2% TTK. These results indicate that TTK extract improved immobility in the forced swimming test, suggesting this beneficial compound ameliorated depression in rats.

4. Discussion

Herbal extracts have recently been reported as complementary therapies for antidepressant purposes, and this type of treatment is expected to prevent onset of mood disorders and regulate serotonin reuptake activity [35, 36]. However, these alternative remedies are limited in the treatment of severe depression [9, 37]. In the present study, we examined TPH-1 and TPH-2 mRNA expression levels in RBL-2H3 cells after treatment with 0, 50, and 100 μg/mL of TTK. Quantitative real-time RT-PCR analysis revealed that mRNA expression of TPH-2 was dose-dependently up-regulated by TTK extract (50 and 100 μg/mL). In addition, mRNA expression of TPH-1 was significant reduced following treatment with all concentrations of TTK extract. TPH is an isoenzyme, and it is involved in the serotonin synthesis and has two different isoforms, TPH-1 and TPH-2 [33, 38]. TPH-1 is utilized mainly in peripherals such as enterochromaffin cells of the gut, whereas TPH-2 is the predominant gene transcribed in the brain [33, 38]. Interestingly, the serotonins of brain and peripherals might be linked, acting as a regulatory interface for neurotransmitters [39]. Up-regulation of TPH-2 transcription induces TPH activity and 5-HT release, which influence synaptic 5-HT activity [40, 41]. We also observed that SERT transcription was significantly down-regulated by TTK extract in RBL-2H3 cells.

SERT is a member of neurotransmitter-sodium symporter, and it plays an important role in the released and extinguished serotonin through transport across the presynaptic membrane [41], and numerous studies have reported the antidepressant effects of reduction of SERT mRNA expression [42, 43]. In the current study, we investigated whether or not reduction of SERT transcription can regulate 5-HT reuptake activity in TTK-treated RBL-2H3 cells. Our results show that 5-HT reuptake activity was dose-dependently reduced by TTK treatment in LPS-induced RBL-2H3 cells, and this pattern was also observed in the SSRI (Fluoxetine; 10 μM)-treated group. The serotonergic system has long been related in the pathogenesis of depression, and the potential evidence involves the inhibition of depression by SSRIs [44]. Other studies have indicated that herbal extracts and their ingredients may exert SSRI-like effects in in vitro and in vivo models [44, 45]. These data suggest that TTK extract may be critical for expression of TPH-1, TPH-2, and SERT as well as inhibition of 5-HT reuptake activity in RBL-2H3 cells via a mechanism similar to those of SSRIs.

In the present study, we determined that rats fed TTK extract (0.5%, 1%, and 2%) for 8 weeks showed up-regulation of serotonin levels in serum or the reduction of immobility in behavioral test upon 1% and 2% TTK treatment, and the data have already been collected by patent office in South Korea [46]. Peripheral serotonin has long been reported to be the suitable marker for diagnosis of depression, as blood serotonin shares a similar serotonin uptake and release mechanism as serotonergic neurons [4749]. Furthermore, the forced swimming test is widely used to screen potential antidepressive effects in vivo, and antidepressants reduce immobility time in this test [50, 51]. Several important clinical implications have emerged based on the finding that 5-HT is associated with the behavioral effects of SSRIs in the forced swimming test [50, 51].

The present study assessed the expression of TPH-1, TPH-2, and SERT as well as 5-HT reuptake activity in RBL-2H3 cells and described serum levels of serotonin and immobility time in OVX female rats. Based on the findings, it appears that TTK may be a potent therapeutic agent for the treatment of depression based on its regulation of serotonin-mediated genes and peripheral serotonin level(s) in our in vitro and in vivo model. However, TTK crude extract contains variety of compounds, and further studies are needed on fractions or partial purification of the extract to identify the active pharmaceutical ingredient among the TTK-derivative compounds.

Data Availability

All data used to support the findings of this study are included within the article.

Conflicts of Interest

All authors declared that there are no conflicts of interest.

Authors’ Contributions

Hyun Yang, Hye Jin Kim, Eui-Ju Hong, Bo-Jeong Pyun, Byung-Seob Ko, and Hye Won Lee performed the research, analyzed the data, and wrote the manuscript; Eui-Ju Hong and Hyun Yang performed in vivo experiments and data analysis; Hye Jin Kim performed in vitro experiments and data analysis. All authors read and approved the final manuscript. Hyun Yang and Hye Jin Kim contributed equally.

Acknowledgments

This work was supported by grants from the Korea Institute of Oriental Medicine (Grants No. K18292 and K16630).

References

  1. S. H. Kennedy, “Core symptoms of major depressive disorder: Relevance to diagnosis and treatment,” Dialogues in Clinical Neuroscience, vol. 10, no. 3, pp. 271–277, 2008. View at: Google Scholar
  2. R. T. Joffe, “Hormone treatment of depression,” Dialogues in Clinical Neuroscience, vol. 13, no. 1, pp. 127–138, 2011. View at: Google Scholar
  3. J. Studd, “Hormone therapy for reproductive depression in women,” Post Reproductive Health, vol. 20, no. 4, pp. 132–137, 2014. View at: Publisher Site | Google Scholar
  4. A. C. Moreira, A. M. Silva, M. S. Santos, and V. A. Sardão, “Phytoestrogens as alternative hormone replacement therapy in menopause: What is real, what is unknown,” The Journal of Steroid Biochemistry and Molecular Biology, vol. 143, pp. 61–71, 2014. View at: Publisher Site | Google Scholar
  5. J. A. Ryuk, B.-S. Ko, H. W. Lee et al., “Tetragonia tetragonioides (Pall.) Kuntze protects estrogen-deficient rats against disturbances of energy and glucose metabolism and decreases proinflammatory cytokines,” Experimental Biology and Medicine, vol. 242, no. 6, pp. 593–605, 2017. View at: Publisher Site | Google Scholar
  6. B. Pyun, H. Yang, E. Sohn et al., “Tetragonia tetragonioides (Pall.) Kuntze Regulates Androgen Production in a Letrozole-Induced Polycystic Ovary Syndrome Model,” Molecules, vol. 23, no. 5, p. 1173, 2018. View at: Publisher Site | Google Scholar
  7. Y. Lee, S. Kim, H. Yuk, G. Lee, and D. Kim, “Tetragonia tetragonoides (Pall.) Kuntze (New Zealand Spinach) Prevents Obesity and Hyperuricemia in High-Fat Diet-Induced Obese Mice,” Nutrients, vol. 10, no. 8, p. 1087, 2018. View at: Publisher Site | Google Scholar
  8. M. Al-Akoum, E. Maunsell, R. Verreault, L. Provencher, H. Otis, and S. Dodin, “Effects of Hypericum perforatum (St. John's wort) on hot flashes and quality of life in perimenopausal women: A randomized pilot trial,” Menopause, vol. 16, no. 2, pp. 307–314, 2009. View at: Publisher Site | Google Scholar
  9. R. C. Shelton, “St John's wort (Hypericum perforatum) in major depression,” Journal of Clinical Psychiatry, vol. 70, no. 5, pp. 23–27, 2009. View at: Publisher Site | Google Scholar
  10. P. L. Gerbarg and R. P. Brown, “Pause menopause with Rhodiola rosea, a natural selective estrogen receptor modulator,” Phytomedicine, vol. 23, no. 7, pp. 763–769, 2016. View at: Publisher Site | Google Scholar
  11. V. Kumar, “Potential medicinal plants for CNS disorders: an overview,” Phytotherapy Research, vol. 20, no. 12, pp. 1023–1035, 2006. View at: Publisher Site | Google Scholar
  12. A. V. Dwyer, D. L. Whitten, and J. A. Hawrelak, “Herbal medicines, other than St. John's Wort, in the treatment of depression: A systematic review,” Alternative Medicine Review, vol. 16, no. 1, pp. 40–49, 2011. View at: Google Scholar
  13. J. Sarris, A. Panossian, I. Schweitzer, C. Stough, and A. Scholey, “Herbal medicine for depression, anxiety and insomnia: a review of psychopharmacology and clinical evidence,” European Neuropsychopharmacology, vol. 21, no. 12, pp. 841–860, 2011. View at: Publisher Site | Google Scholar
  14. N. Gordon and G. Goelman, “Understanding alterations in serotonin connectivity in a rat model of depression within the monoamine-deficiency and the hippocampal-neurogenesis frameworks,” Behavioural Brain Research, vol. 296, pp. 141–148, 2016. View at: Publisher Site | Google Scholar
  15. C.-J. Scholz, S. Jungwirth, W. Danielczyk et al., “Investigation of association of serotonin transporter and monoamine oxidase-A genes with Alzheimer's disease and depression in the VITA study cohort: A 90-month longitudinal study,” American Journal of Medical Genetics Part B: Neuropsychiatric Genetics, vol. 165, no. 2, pp. 184–191, 2014. View at: Publisher Site | Google Scholar
  16. E. Akimova, R. Lanzenberger, and S. Kasper, “The Serotonin-1A Receptor in Anxiety Disorders,” Biological Psychiatry, vol. 66, no. 7, pp. 627–635, 2009. View at: Publisher Site | Google Scholar
  17. M. J. Millan, P. Marin, J. Bockaert, and C. Mannoury la Cour, “Signaling at G-protein-coupled serotonin receptors: recent advances and future research directions,” Trends in Pharmacological Sciences, vol. 29, no. 9, pp. 454–464, 2008. View at: Publisher Site | Google Scholar
  18. C. Normann, S. Frase, V. Haug et al., “Antidepressants Rescue Stress-Induced Disruption of Synaptic Plasticity via Serotonin Transporter–Independent Inhibition of L-Type Calcium Channels,” Biological Psychiatry, vol. 84, no. 1, pp. 55–64, 2017. View at: Publisher Site | Google Scholar
  19. R. J. Orleans, L. Li, M.-J. Kim et al., “FDA approval of paroxetine for menopausal hot flushes,” The New England Journal of Medicine, vol. 370, no. 19, pp. 1777–1779, 2014. View at: Publisher Site | Google Scholar
  20. L. Williams, M. Henry, M. Berk et al., “SSRI use and bone mineral density in women with a history of depression: Geelong Osteoporosis Study,” Acta Neuropsychiatrica, vol. 18, no. 06, pp. 311-312, 2006. View at: Publisher Site | Google Scholar
  21. D. R. Rubinow, P. J. Schmidt, and C. A. Roca, “Estrogen-serotonin interactions: Implications for affective regulation,” Biological Psychiatry, vol. 44, no. 9, pp. 839–850, 1998. View at: Publisher Site | Google Scholar
  22. C. Barth, A. Villringer, and J. Sacher, “Sex hormones affect neurotransmitters and shape the adult female brain during hormonal transition periods,” Frontiers in Neuroscience, vol. 9, 2015. View at: Google Scholar
  23. C. Chojnacki, E. Walecka-Kapica, G. Klupinska, M. Pawlowicz, A. Blonska, and J. Chojnacki, “Effects of fluoxetine and melatonin on mood, sleep quality and body mass index in postmenopausal women,” Journal of Physiology and Pharmacology, vol. 66, no. 5, pp. 665–671, 2015. View at: Google Scholar
  24. G. M. James, P. Baldinger-Melich, C. Philippe et al., “Effects of selective serotonin reuptake inhibitors on interregional relation of serotonin transporter availability in major depression,” Frontiers in Human Neuroscience, vol. 11, 2017. View at: Google Scholar
  25. M. J. Taylor, S. Sen, and Z. Bhagwagar, “Antidepressant response and the serotonin transporter gene-linked polymorphic region,” Biological Psychiatry, vol. 68, no. 6, pp. 536–543, 2010. View at: Google Scholar
  26. R. W. Invernizzi, “Role of TPH-2 in brain function: News from behavioral and pharmacologic studies,” Journal of Neuroscience Research, vol. 85, no. 14, pp. 3030–3035, 2007. View at: Publisher Site | Google Scholar
  27. D. H. Park, D. M. Stone, H. Baker, K. S. Kim, and T. H. Joh, “Early induction of rat brain tryptophan hydroxylase (TPH) mRNA following parachlorophenylalanine (PCPA) treatment,” Brain Research, vol. 22, no. 1-4, pp. 20–28, 1994. View at: Publisher Site | Google Scholar
  28. M. L. López-Narváez, C. A. Tovilla-Zárate, T. B. González-Castro et al., “Association analysis of TPH-1 and TPH-2 genes with suicidal behavior in patients with attempted suicide in Mexican population,” Comprehensive Psychiatry, vol. 61, pp. 72–77, 2015. View at: Publisher Site | Google Scholar
  29. M. S. Rahman and P. Thomas, “Molecular cloning, characterization and expression of two tryptophan hydroxylase (TPH-1 and TPH-2) genes in the hypothalamus of Atlantic croaker: Down-regulation after chronic exposure to hypoxia,” Neuroscience, vol. 158, no. 2, pp. 751–765, 2009. View at: Publisher Site | Google Scholar
  30. P. Blier and C. de Montigny, “Current advances and trends in the treatment of depression,” Trends in Pharmacological Sciences, vol. 15, no. 7, pp. 220–226, 1994. View at: Publisher Site | Google Scholar
  31. D. J. Walther and M. Bader, “A unique central tryptophan hydroxylase isoform,” Biochemical Pharmacology, vol. 66, no. 9, pp. 1673–1680, 2003. View at: Publisher Site | Google Scholar
  32. D. J. Walther, J.-U. Peter, S. Bashammakh et al., “Synthesis of serotonin by a second tryptophan hydroxylase isoform,” Science, vol. 299, no. 5603, p. 76, 2003. View at: Publisher Site | Google Scholar
  33. S. Matthes, V. Mosienko, S. Bashammakh, N. Alenina, and M. Bader, “Tryptophan hydroxylase as novel target for the treatment of depressive disorders,” Pharmacology, vol. 85, no. 2, pp. 95–109, 2010. View at: Publisher Site | Google Scholar
  34. T. Posser, M. P. Kaster, S. C. Baraúna, J. B. T. Rocha, A. L. S. Rodrigues, and R. B. Leal, “Antidepressant-like effect of the organoselenium compound ebselen in mice: evidence for the involvement of the monoaminergic system,” European Journal of Pharmacology, vol. 602, no. 1, pp. 85–91, 2009. View at: Publisher Site | Google Scholar
  35. H. Matsuzaki, Y. Shimizu, N. Iwata et al., “Antidepressant-like effects of a water-soluble extract from the culture medium of Ganoderma lucidum mycelia in rats,” BMC Complementary and Alternative Medicine, vol. 13, article 370, 2013. View at: Publisher Site | Google Scholar
  36. K. L. Regan, “Depression treatment with selective serotonin reuptake inhibitors for the postacute coronary syndrome population: A literature review,” Journal of Cardiovascular Nursing, vol. 23, no. 6, pp. 489–496, 2008. View at: Publisher Site | Google Scholar
  37. C. A. Fornal, C. W. Metzler, C. Mirescu, S. K. Stein, and B. L. Jacobs, “Effects of standardized extracts of St. John's wort on the single-unit activity of serotonergic dorsal Raphe neurons in awake cats: comparisons with fluoxetine and sertraline,” Neuropsychopharmacology, vol. 25, no. 6, pp. 858–870, 2001. View at: Google Scholar
  38. R. L. Sanchez, A. P. Reddy, M. L. Centeno, J. A. Henderson, and C. L. Bethea, “A second tryptophan hydroxylase isoform, TPH-2 mRNA, is increased by ovarian steroids in the raphe region of macaques,” Brain Research, vol. 135, no. 1-2, pp. 194–203, 2005. View at: Publisher Site | Google Scholar
  39. J. E. Hardebo and C. Owman, “Barrier mechanisms for neurotransmitter monoamines and their precursors at the blood‐brain interface,” Annals of Neurology, vol. 8, no. 1, pp. 1–31, 1980. View at: Publisher Site | Google Scholar
  40. F. Chamas, L. Serova, and E. L. Sabban, “Tryptophan hydroxylase mRNA levels are elevated by repeated immobilization stress in rat raphe nuclei but not in pineal gland,” Neuroscience Letters, vol. 267, no. 3, pp. 157–160, 1999. View at: Publisher Site | Google Scholar
  41. P. D. Charles, G. Ambigapathy, P. Geraldine, M. A. Akbarsha, and K. E. Rajan, “Bacopa monniera leaf extract up-regulates tryptophan hydroxylase (TPH2) and serotonin transporter (SERT) expression: implications in memory formation,” Journal of Ethnopharmacology, vol. 134, no. 1, pp. 55–61, 2011. View at: Publisher Site | Google Scholar
  42. J. F. Neumaier, D. C. Root, and M. W. Hamblin, “Chronic fluoxetine reduces serotonin transporter mRNA and 5-HT(1B) mRNA in a sequential manner in the rat dorsal raphe nucleus,” Neuropsychopharmacology, vol. 15, no. 5, pp. 515–522, 1996. View at: Publisher Site | Google Scholar
  43. S. Benmansour, M. Cecchi, D. A. Morilak et al., “Effects of chronic antidepressant treatments on serotonin transporter function, density, and mRNA level,” The Journal of Neuroscience, vol. 19, no. 23, pp. 10494–10501, 1999. View at: Publisher Site | Google Scholar
  44. D. G. Machado, L. E. B. Bettio, M. P. Cunha et al., “Antidepressant-like effect of the extract of Rosmarinus officinalis in mice: Involvement of the monoaminergic system,” Progress in Neuro-Psychopharmacology & Biological Psychiatry, vol. 33, no. 4, pp. 642–650, 2009. View at: Publisher Site | Google Scholar
  45. L. B. Sunny Edet Ohia, J. Robinson, Y. F. Njie-Mbye, and D. Bagchi, “Inhibitory Effects of Green Coffee Bean Extract on Serotonin Uptake in the Rat Brain Cortex,” The FASEB Journal, vol. 30, no. 1, 2016. View at: Google Scholar
  46. H. W. Lee, B. S. Ko, and H. Yang, “Composition for preventing, improving or treating depression caused by estrogen secretion decrease comprising Tetragonia tetragonoides extract as effective component,” Republic of Korea patent 1018744600000, 2018. View at: Google Scholar
  47. A. Camacho and J. E. Dimsdale, “Platelets and psychiatry: Lessons learned from old and new studies,” Psychosomatic Medicine, vol. 62, no. 3, pp. 326–336, 2000. View at: Publisher Site | Google Scholar
  48. I. Barišić, N. Pivac, D. Mück-Šeler, M. Jakovljević, and M. Šagud, “Comorbid Depression and Platelet Serotonin in Hemodialysis Patients,” Nephron Clinical Practice, vol. 96, no. 1, pp. c10–c14, 2004. View at: Publisher Site | Google Scholar
  49. D. J. Newport, M. J. Owens, D. L. Knight et al., “Alterations in platelet serotonin transporter binding in women with postpartum onset major depression,” Journal of Psychiatric Research, vol. 38, no. 5, pp. 467–473, 2004. View at: Publisher Site | Google Scholar
  50. F. Borsini and A. Meli, “Is the forced swimming test a suitable model for revealing antidepressant activity?” Psychopharmacology, vol. 94, no. 2, pp. 147–160, 1988. View at: Publisher Site | Google Scholar
  51. I. Lucki, “The forced swimming test as a model for core and component behavioral effects of antidepressant drugs,” Behavioural Pharmacology, vol. 8, no. 6-7, pp. 523–532, 1997. View at: Publisher Site | Google Scholar

Copyright © 2019 Hyun Yang et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

802 Views | 272 Downloads | 1 Citation
 PDF  Download Citation  Citation
 Download other formatsMore
 Order printed copiesOrder

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.