Evidence-Based Complementary and Alternative Medicine / 2019 / Article / Tab 1

Research Article

Protective Effect and Mechanisms of New Gelatin on Chemotherapy-Induced Hematopoietic Injury Zebrafish Model

Table 1

Primers used in real-time PCR.

GenePrimer orientationSequence of primer (5′-3′)

β-ActinForwardGAACCGCTGCCTCTTCTTCCTCC
ReverseCCCTGTTAGACAACTACCTCCCTTT
runx1ForwardACATATCAGAGAGCCATAAAG
ReverseCAGATATGGATACGACTGC
sclForwardTCCCAGAGACCCGCTGAGCG
ReverseCAGGAGGGTGTGTTGGGATG
pu.1ForwardAGAGAGGGTAACCTGGACTG
ReverseAAGTCCACTGGATGAATGTG
c-mybForwardTTTCTACCGAATCGAACAGATG
ReverseCAATCACCCGTTGGTCTTCT
GATA1ForwardAAGATGGGACAGGCCACTAC
ReverseTGCTGACAATCAGCCTCTTTT

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.