Evidence-Based Complementary and Alternative Medicine

Evidence-Based Complementary and Alternative Medicine / 2020 / Article

Research Article | Open Access

Volume 2020 |Article ID 1842347 | https://doi.org/10.1155/2020/1842347

Gaohui Mao, Liqin Sun, Jinwen Xu, Yiming Li, Ciren Dunzhu, Liuqiang Zhang, Fei Qian, "Scrodentoids H and I, a Pair of Natural Epimerides from Scrophularia dentata, Inhibit Inflammation through JNK-STAT3 Axis in THP-1 Cells", Evidence-Based Complementary and Alternative Medicine, vol. 2020, Article ID 1842347, 11 pages, 2020. https://doi.org/10.1155/2020/1842347

Scrodentoids H and I, a Pair of Natural Epimerides from Scrophularia dentata, Inhibit Inflammation through JNK-STAT3 Axis in THP-1 Cells

Academic Editor: Antonella Fioravanti
Received13 Mar 2020
Accepted30 Jun 2020
Published27 Jul 2020

Abstract

Background. Scrophularia dentata is an important medicinal plant and used for the treatment of exanthema and fever in Traditional Tibetan Medicine. Scrodentoids H and I (SHI), a pair of epimerides of C19-norditerpenoids isolated from Scrophularia dentata, could transfer to each other in room temperature and were firstly reported in our previous work. Here, we first reported the anti-inflammatory effects of SHI on LPS-induced inflammation. Purpose. To evaluate the anti-inflammatory property of SHI, we investigated the effects of SHI on LPS-activated THP-1 cells. Methods. THP-1 human macrophages were pretreated with SHI and stimulated with LPS. Proinflammatory cytokines IL-1β and IL-6 were measured by RT-PCR and enzyme-linked immunosorbent assays (ELISA). The mechanism of action involving phosphorylation of ERK, JNK, P38, and STAT3 was measured by western Blot. The NF-κB promoter activity was evaluated by Dual-Luciferase Reporter Assay System in TNF-α stimulated 293T cells. Results. SHI dose-dependently reduced the production of proinflammatory cytokines IL-1β and IL-6. The ability of SHI to reduce production of cytokines is associated with phosphorylation depress of JNK and STAT3 rather than p38, ERK, and NF-κB promoter. Conclusions. Our experimental results indicated that anti-inflammatory effects of SHI exhibit attenuation of LPS-induced inflammation and inhibit activation through JNK/STAT3 pathway in macrophages. These results suggest that SHI might have a potential in treating inflammatory disease.

1. Introduction

Inflammation is a series of complex physiological reactions caused by persistent infection or dysregulation of immune responses in healthy tissues. It is an important process to remove exogenous stimuli and tissue damaged from the stimuli followed by initiating tissue repair, which is involved in the pathological processes of many diseases [1]. There are several immune cells involving inflammatory response, such as macrophages, neutrophils, and mononuclear phagocytes that secrete inflammatory mediators and inflammatory proteins upon stimulation by exogenous stimuli such as lipopolysaccharides (LPS) [2]. Macrophages are innate immune sentinels that patrol most tissues in the body. These cells detect changes in the microenvironment, including pathogen invasion and tissue damage, and mediate inflammatory processes, in response, that destroy microbial interlopers, remove and repair damaged tissue, and restore homeostasis [3]. Macrophages are versatile cells that orchestrate both the induction and the resolution of inflammation. Macrophages are crucial actors in innate immunity and modulating inflammatory response; therefore, activated macrophages are involved in the pathogenesis of multiple diseases. LPS is the major component of Gram-negative bacteria and one of the most potent inducers of inflammation. LPS can stimulate macrophages to release proinflammatory mediators and cytokines such as interleukin-6 (IL-6), tumor necrosis factor-α (TNF-α), interleukin-1 beta (IL-1β), activating mitogen-activated protein kinase (MAPK), nuclear factor-κB (NF-κB), and signal transducer and activator of transcription 3 (STAT3) pathway [4]. Toll-like receptor 4 (TLR4) activation caused by endotoxin with subsequent cytokine production is, in principle, beneficial for the organism, but when this process became dysregulated can lead to life-threatening syndromes [5, 6]. In the evolutionary context, control of overexuberant inflammation in order to maintain cell function is important to organism.

Pimarane diterpenoids are a complex group of plant-derived chemicals that have anti-inflammation [7, 8], anti-tumor [911], antimicrobial [12], vasorelaxant activity [13] and antifungal, antiviral, antispasmodic, and relaxant effects [14, 15]. Some of this type diterpenes exhibited dose-dependent inhibition of nitric oxide (NO) production [11, 16] and have been discovered as novel COX-2 inhibitors for the development of anti-inflammatory agents [17]. As a result of their efficacy in these settings, the search for new and biologically active pimarane diterpenoids has been on-going. Scrodentoids H and I (SHI) is a pair of epimerides of C19-norditerpenoids which belong to pimarane diterpenoids. They could transfer to each other in room temperature and the purified scrodentoid H or scrodentoid I could not be obtained. We firstly reported in our previous work [18]. SHI was isolated from Scrophularia dentate that is used for the treatment of exanthema and fever in Traditional Tibetan Medicine [18]. S. dentata has good effect on inflammation diseases. In our previous studies, we have reported some ingredient [19, 20] and pharmacology of this plant [21, 22]. SHI was an important diterpene isolated from this plant; however, the anti-inflammatory effect of SHI, as a novel natural compound, has not been researched.

In this study, we investigated the role of SHI in the LPS-stimulated inflammatory response through THP-1 cell model. THP-1, a human leukemia monocytic cell line, has been extensively modeled and used for investigating anti-inflammatory effects of compounds due to its unique characteristics [23]. The cells were usually stimulated with LPS, being in an activation state. We chose THP-1 as a model system because this cell line can be activated by LPS and can produce proinflammatory mediators such as TNF-α, IL-1β, and IL-6. In addition, it has been suggested that some diterpenes may have anti-inflammatory activity, particularly in LPS-induced macrophage responses [2426]. Here, we found the anti-inflammatory effects of SHI on LPS-induced THP-1 cells, and it effectively inhibited these inflammatory through JNK-STAT3 axis.

2. Materials and Methods

2.1. Materials

THP-1 cells were purchased from the Chinese Academy of Sciences cell bank (Shanghai, China). 293T cells were saved in our group. LPS from Escherichia coli O111:B4 was purchased from Sigma Aldrich (St. Louis, MO, USA). Cell Proliferation Kit II was purchased from Roche (Germany). All PCR relative reagents were purchased from Thermo fisher (USA).

SHI was isolated and purified from Scrophularia dentata Royle ex Benth by our group as previous study [18], and the purity of SHI is more than 98%. SHI was dissolved in DMSO and stored in 50 mM concentration which was shown as the weight of SHI.

p-JNK, JNK, p-P38, P38, p-STAT3, and STAT3 antibodies were purchased from Cell Signaling Technology (USA). SP600125 inhibitor was purchased from Selleck Chemicals (USA). RIPA, BSA, PMSF, Nuclear and Cytoplasmic Protein Extraction Kit, and BCA Protein Assay Kit were purchased from Beyotime (China).

All chemicals were purchased from Sinopharm Chemical Reagent Co., Ltd., unless stated otherwise.

2.2. Cell Culture

THP-1 was cultured using Roswell Park Memorial Institute-1640 media (RPMI 1640) containing 10% fetal bovine serum (Gibco, Invitrogen, USA) and incubated at 37°C in 5% CO2/95% air. THP-1 cells were cultured in 100 mm dish and passage every three days. During experiments, the cells were plated in 96-well plates or 24-well plates.

2.3. Cell Viability

Cell viability was assessed using 2,3-bis[2-methoxy-4-nitro-5-sulfophenyl]-2H-tetrazolium-5-carboxanilide (XTT) assay. Cells were plated in 96-well plates at a density of 5 × 103 cells/well and incubated with sample compounds. After culturing for 24 hours at 37°C, a solution of XTT and phenazine methosulfate (PMS) was added, and the culture was incubated for an additional 4 h. The absorbance at 492 nm and 690 nm was measured on a 96-well plate with a microplate reader. The percentage of cell viability was calculated as = (ODtest492 − ODtest690)/(ODcontrol492 − ODcontrol690) × 100%.

2.4. Quantitative Real-Time PCR

THP-1 cells were plated onto 24-well plates (2 × 106 cells/well) and treated with different concentrations of compound SHI (10, 20, 40 and 60 μM) or SP600125 for 1 h, followed by incubation with or without 1 μg/ml LPS for 4 h. Then, total RNA was extracted from cells using Trizol. cDNA was synthesized from isolated total RNA using first strand cDNA synthesis kit (Thermo Scientific). Quantitative real-time PCR was carried out using gene specific primers (Table 1) and SYBR Green PCR Master Mix (Thermo Scientific) in a total volume of 20 μL on Step One Plus Real-Time PCR System (Applied Biosystems). The relative expressions were expressed as fold change as determined by the relative quantification algorithm 2−ΔΔCT Method.


GeneForward primer (5′-3′)Reverse primer (5′-3′)

IL-1βTGAAATGATGGCTTATTACAGTGGCGTAGTGGTGGTCGGAGATTCGTAG
IL-6CCTCCAGAACAGATTTGAGAGTAGTGGGTCAGGGGTGGTTATTGC
GAPDHCGCTGAGTACGTCGTGGAGTCGCTGATGATCTTGAGGCTGTTGTC

2.5. Luciferase Assay

To assess NF-κB promoter activity, 293T cells were transiently transfected with a luciferase reporter gene. Cells were plated one day prior to transfection, so that cells will be approximately 80% confluent on the day of transfection. On the day of transfection, DNA was diluted to 0.4 μg per 60 μL of serum-free medium, and an Attractene Transfection Reagent (QIAGEN, Germany) 1.5 μL was added to achieve the proper ratio of reagent to DNA. The mixture was incubated for 20 minutes, and 60 μL per DNA mixture was added to each well to be transfected. The effects of SHI on NF-κB promoter activity were determined in 293T cells transfected with the pGL3-NF-κB promoter luciferase construct, pRL-SV40 as an internal reference. Cells were transfected for 5 hours before changing to fresh media. One hour after changing to fresh media, 10 ng/mL TNF-α was added to the cells for 16 hours. Luciferase activity was measured in the cell lysates using the Dual-Luciferase Reporter Assay System according to the manufacturer’s instructions (Promega, USA).

2.6. Enzyme-Linked Immunosorbent Assays (ELISA)

THP-1 cells at a density of 2 × 106 cells/mL were incubated in 24-well plates with or without different concentrations of SHI for 1 hr and then induced with LPS (1 μg/mL) for 24 hrs. Then, the supernatant was collected for measurement of cytokines. The concentrations of human IL-1β in culture supernatants were determined using the Duoset ELISA kits for cytokine (R&D Systems). The concentrations of cytokines IL-6 were measured using ELISA kits (invitrogen), according to the manufacturer’s instructions.

2.7. Western Blot Analysis

THP-1 cells were pretreated with SHI for 1 hr and then stimulated with for 30 min or 4 hrs. After the treatments, cell lysates were prepared using radioimmunoprecipitation assay (RIPA) (Beyotime, China) and lysis buffer containing protease and phosphatase inhibitor cocktails. In another part of the experiment, cells were lysed in a Nuclear and Cytoplasmic Protein Extraction Kit (Beyotime, China) in order to obtain cytosol and nuclear fractions. The protein concentration was measured using the Bicinchoninic Acid (BCA) Protein Assay Kit (Beyotime, China). Equal concentrations of protein were separated using a 10% SDS-PAGE and transferred to PVDF membranes. After blocking, the membranes were incubated with antibodies against GAPDH, c-Jun N-terminal kinase (JNK), phospho-JNK, ERK, phospho-ERK, P38, phospho-P38, STAT3, phospho-STAT3 (Cell Signaling Technology, USA), and Lamin B (Santa Cruz Biotechnology, USA). The membranes were incubated with horseradish peroxidase- (HRP-) conjugated secondary antibodies (Cell Signaling Technology, USA) and developed using the enhanced chemiluminescence (ECL) detection system (Millipore, Eschborn, Germany).Protein activity was determined using a Chemiluminescent Imaging System (Tanon 5200 Multi) and Gel Image System (Tanon, China).

Protein was extracted for detecting p-ERK, ERK, p-P38, P38 p-JNK, JNK, and GAPDH antibodies for whole cell lysates and p-STAT3, STAT3, and Lamin B for nuclear fraction of THP-1 macrophages.

2.8. Statistical Analysis

All data were expressed as means ± SEM. Each value is the mean of three independent experiments. Statistical analysis was assessed via one-way ANOVA followed by Tukey post-hoc test by GraphPad Prism 6 (GraphPad, San Diego, CA, USA). A value of was considered statistically significant.

3. Result

3.1. Cell Viability Validation of SHI

The chemical structures of SHI are shown in Figure 1(a). Before the anti-inflammation effect of SHI was measured, we referred to the testing concentration of compounds also from Scrophularia dentata Royle ex Bent [21, 22], and SHI was subjected to cytotoxic evaluation against THP-1 cell by XTT assay. After pretreatment with SHI treatment for 24 h, SHI did not find any cytotoxicity within 60 μM in the XTT test of THP-1 cells (Figure 1(b)). Therefore, we used SHI at concentrations up to 60 μM for all in vitro experiments.

3.2. SHI Inhibited IL-1β and IL-6 Production in THP-1 Cells

To determine the anti-inflammatory effect of SHI, we examined the expression of IL-1β and IL-6 in LPS-induced THP-1 cells. We found that the mRNA levels of IL-1β (Figure 2(a)) and IL-6 (Figure 2(b)) were significantly increased after LPS-stimulated THP-1 cells for 4 h, and SHI significantly inhibited the expression of IL-1β and IL-6. Subsequently, we used ELISA to confirm the effect of SHI on the secretion of IL-1β and IL-6. As shown in Figures 2(c) and 2(d), the secretion of IL-1β (Figure 2(c)) and IL-6 (Figure 2(d)) exceeds 1000 pg/mL and 200 pg/mL, respectively. Pretreatment with SHI effectively inhibited the production of IL-1β and IL-6 in a concentration-dependent manner. Moreover, SHI at 60 μM reduced the secretion of IL-6 up to 89.95%.

3.3. The Effect of SHI on NF-κB Activity

Most of studies on terpenes have focused on NF-κB pathway as a common target in explaining their anti-inflammatory and immunomodulatory effects [27, 28], particularly in pimarane diterpenes [29, 30]. Therefore, we explored whether SHI has effect on NF-κB promoter activity or not. We used the Dual-Luciferase Reporter Assay System to detect luciferase activity of 293T cell lysates which has been transfected with the pGL3-NF-κB promoter luciferase with SHI processing. However, SHI did not inhibit NF-κB promoter activity (Figure 3). Thus, we speculate that the molecular mechanism of SHI on inflammation response might be not related to NF-κB.

3.4. SHI Downregulated the Phosphorylation of STAT3

Because IL-6 is mainly involved in the STAT pathway activation promoting acute and chronic inflammatory diseases and SHI has shown good IL-6 inhibitory activity, we examined the effect of SHI on the phosphorylation of STAT3. Cells were treated with LPS (1 μg/ml) in the presence or absence of SHI for 4 h, and nuclear proteins were extracted for Western blot analysis to determine the expression levels of p-STAT3 and STAT3. As shown in Figure 4, after stimulation of LPS, p-STAT3 expression was significantly increased, and pretreatment with SHI considerably inhibited the phosphorylation of STAT3 in a dose-dependent manner.

3.5. SHI Decreased the Phosphorylation of JNK rather than ERK and P38

MAPK signaling is another important pathway in inflammation response. Here, we tested the effect of SHI on the phosphorylation of ERK, P38, and JNK by western blot. We found that p-ERK, p-P38, and p-JNK were all increased after LPS was stimulated for 30 min in the THP-1 cell, but SHI did not alter the levels of p-ERK and p-P38 (Figure 5(a)). However, the upregulation of the phosphorylation of JNK was significantly attenuated following pretreatment with SHI (Figures 5(b) and 5(c)).

3.6. SP600125 Reduced the Phosphorylation of STAT3

The aforementioned data showed that p-JNK increased after LPS stimulation for 30 min in THP-1 cells, and p-STAT3 was changed after 4 h of LPS stimulation. However, no report about the relationship between JNK and STAT3 in the THP-1 cells was found. Here, we hypothesized that JNK might regulate the activity of STAT3, thereby promoting the release of inflammatory mediators in THP-1 cells.

To further elucidate the mechanism of SHI in LPS-stimulated THP-1 cells and the above hypothesis, the phosphorylation of STAT3 was measured by western blot utilizing JNK inhibitor SP600125. Data showed that SP600125 significantly inhibited the phosphorylation of STAT3 in THP-1 cells (Figures 6(a) and 6(b)). These results implied that LPS-mediated STAT3 signal transduction in THP-1 cells may be regulated by JNK pathways.

3.7. The Effect of SP600125 on Cytokines Production in LPS-Induced THP-1 Cells

To further confirm the relationship between the anti-inflammation effect of SHI and JNK signaling pathway, we investigated the effect of JNK- inhibition on IL-1β and IL-6 mRNA levels. Thus, THP-1 cells were pretreated with SHI for 1 h, followed by LPS stimulated for 4 h. As shown in Figure 7, SP600125 suppressed LPS-induced IL-1β expression in a dose-dependent manner in THP-1 cells (Figure 7(a)). However, SP600125 was not reduced IL-6 mRNA levels (Figure 7(b)). Therefore, these results indicated that IL-6 is upstream of STAT3, and it might be stimulated by autocrine.

4. Discussion

Scrophularia dentata is used for the treatment of exanthema and fever in Traditional Tibetan Medicine. SHI is an important diterpene isolated from this plant; however, SHI as a novel natural compound has not been researched. In this study, we first reported its anti-inflammatory effects on LPS-induced THP-1 cells via JNK/STAT3 axis.

Inflammation is a part of the immune response against injury or pathogenic infection. Infection or cell damage triggers the release of proinflammatory mediators which play critical roles in the pathogenesis of many acute and chronic diseases. IL-1β, a classic proinflammatory mediator, plays a key role in septic shock, rheumatoid arthritis, inflammatory bowel disease, and type II diabetes and is thus a major therapeutic target [31]. IL-6 is a pleiotropic cytokine that plays an important role in immune and inflammatory responses. In our research, we found that pretreatment with SHI reduced both the mRNA expression and release of IL-1β and IL-6 in LPS-induced THP-1 macrophages (Figure 2).

Signal transduction of proinflammatory cytokines includes many pathways, such as NF-κB, MAPK, and STAT signaling pathway [32]. For example, MAPKs critically contribute to initiate the activation of transcription factor and produce proinflammatory mediators and cytokines and are considered as therapeutic targets of inflammatory diseases [33], especially as JNK. For example, Chrysin could inhibit the release of IL-1β via inhibiting the activation of JNK [34]. In addition, JNK activation in the LPS-induced expression of IL-6 in neutrophils has been described. Inhibition of JNK by its inhibitor SP600125 decreased IL-6 mRNA expression in LPS-stimulated neutrophils in a dose-dependent manner [35]. Also, some data suggest that inhibition of LPS-induced IL-6 production is caused by inhibiting the JNK signaling pathway and activation of AP-1 in microglia [36]. Similarly, it is shown that lower IL-6 and IL-1β were conducive to protect against lethality in sepsis syndrome via the JNK signaling pathway and the transcription factor AP-1 [37]. Therefore, we investigated the involvement of SHI in MAPK activation. Interestingly, SHI significantly suppressed LPS-induced activation of JNK 1/2 (Figures 5(b) and 5(c)) but did not alter the phosphorylation of p38 MAPK and ERK 1/2 (Figure 5(a)). In addition, we measured the effect of SHI on NF-κB which is a key regulator of inflammation; however, SHI did not reduce the increase of NF-κB promoter activity in THP-1 cells (Figure 3).

STAT proteins play a central role in regulating cytokine-dependent inflammation [3840]. 7 STATs (STAT1, STAT2, STAT3, STAT4, STAT5a, STAT5b, and STAT6) are identified and STAT3 is highly associated with inflammatory response. In response to inflammatory stress, STAT3 directly serves as a transcription factor to regulate expression of proinflammatory cytokines [41]. STAT3 activation has been widely reported to maintain epithelial homeostasis and cytokine balance [42, 43]. Therefore, we investigated the effect of SHI on phosphorylation of STAT3. SHI significantly suppressed the phosphorylation of STAT3 in LPS-induced THP-1 cells (Figure 4). Furthermore, we tried to detect the changes of p-JAK2 and JAK2 which is a classic protein that could active the phosphorylation of STAT3. Under our experimental conditions, however, the phosphorylation of LPS-stimulated JAK2 protein was at the edge of the lowest detection limit, and there was no statistical difference between treatment with LPS and no treatment in THP-1 cells (Figures S1 and S2). It is indicated that SHI in THP-1 cells regulates the activation of STAT3 by other pathways.

Above all, the molecular mechanism of SHI is mainly related to JNK and STAT3 pathway. Previous literature report has reported that JNK was located upstream of STAT3 in some types of cells. For example, a study showed that inhibition of JNK reduced G alpha(s)-mediated STAT3 phosphorylation [44]. Furthermore, G proteins have been implicated in TLR4 signaling in macrophages. In response to LPS, G proteins subunit alpha-1 and alpha-3 form complexes containing the pattern recognition receptor CD14, which are required for activation of PI3K-Akt signaling. G proteins deficiency decreased LPS-induced TLR4 endocytosis. These data confirm the importance of G proteins in TLR4-mediated responses in cells and reveal a level of TLR and signaling pathway specificity [45, 46]. The above two sections explain the relationship between the LPS/TLR4- G alpha(s)-JNK- STAT3 axis. However, the relationship between JNK and STAT3 has not been reported in THP-1 cells. Here, we wondered if there was a critical link between the JNK and STAT3 in THP-1 cells. As expected, we found that the phosphorylation level of STAT3 was also regulated by the JNK inhibitor SP600125 (Figure 6), suggesting that inhibition of JNK could affect the activity of STAT3. However, SP600125 suppressed LPS-induced IL-1β expression without altered IL-6 expression (Figure 7). Thus, we hypothesize that the effects of SHI on JNK and STAT3 were produced after LPS stimulation for 30 min and 4 h, respectively, and that other proteins should play a role in this interval. Some literatures have shown that LPS/TRL4 signaling can also produce inflammatory cytokines via the oxidative stress-PYK2-STAT3 pathway [4749]. In addition, a study showed that Pyk2 activated p-JNK and then promoted proinflammatory mediators release in human aortic endothelial cells [50]. Meanwhile, some literatures have reported that PYK2 could regulate the release of IL-6 in different diseases such as cancer and inflammation related diseases [51, 52]. Thus, we speculate that PYK2 may be the key to the tandem action of JNK and STAT3, and this hypothesis remains to be verified experimentally.

Activating STAT3 via G proteins in THP-1 cells by CCR1 agonist, leukotactin-1 (CCL15) could induce IL-6 and IL-8 production. Neutralizing antibody to IL-6 inhibited CCL15-mediated STAT3 Tyr705 phosphorylation, whereas inhibition of STAT3 activity abolished CCL15-activated IL-8 release [53]. IL-6 plus its soluble receptor sIL-6R (IL-6/sIL-6R) promoted THP-1 monocyte migration, and statins blocked IL-6/sIL-6R-induced translocation of STAT3 to the nucleus by inhibiting JAK/STAT signaling cascades [54]. Blocking IL-6/STAT3 signaling defers inflammation responses central to the progression of diabetic nephropathy [55] and atherogenic responses [56]. Moreover, STAT3 inhibition could represent a possible future therapeutic target in systemic lupus erythematosus [57]. However, activation of STAT3 has the capability to drive hepatocyte compensatory proliferation, a key principle of the regenerating liver [58]. Simultaneously, cardiac STAT3 is important for maintaining metabolic homeostasis, and loss of STAT3 in cardiomyocytes makes the heart more susceptible to chronic pathological insult [59]. In recent years, a plethora of studies have convincingly shown that only signaling via the soluble IL-6R (transsignaling) accounts for the deleterious effects of IL-6, whereas classic signaling via the membrane-bound receptor is essential for the regenerative and antibacterial effects of IL-6 (classic signaling) [60]. We also noticed the double-edged effect of STAT3 activation in the muscles, and STAT3 is a critical regulator of satellite cell self-renewal after muscle injury. However, prolonged STAT3 activation in muscles has been shown to be responsible for muscle wasting [61]. STAT3 in various cell types of the gut may individually contribute to the restoration of intestinal homeostasis on the one hand or pave the way for excessive immunopathology on the other, as an inflammatory “rheo-STAT” [62]. STAT3 can have a plethora of effects in inflammation-related diseases. It is important to balance the extent of STAT3 activation and the duration and location (cell types) of the STAT3 signaling when developing therapeutic interventions.

5. Conclusions

In the present study, we firstly demonstrated the anti-inflammatory effects of SHI by attenuating LPS-induced inflammation and inhibiting the JNK/STAT3 pathway in macrophages. Our results suggest SHI, a natural diterpene compound isolated from Scrophularia dentata Royle ex Benth, might have benefit for treating inflammatory-related diseases such as ulcerative colitis and atherosclerotic disease.

Abbreviations

LPS:Lipopolysaccharide
IL-6:Interleukin-6
TNF-α:Tumor necrosis factor-α
IL-1β:Interleukin-1 beta
TLR4:Toll-like receptor 4
COX-2:Cyclooxygenase-2
NO:Nitric oxide
DMSO:Dimethyl sulfoxide
ECL:Enhanced chemiluminescence
FBS:Fetal bovine serum
HRP:Horseradish peroxidase
IL:Interleukin
JNK:c-Jun N-terminal kinase
MAPK:Mitogen-activated protein kinase
RIPA:Radioimmunoprecipitation assay
RT-PCR:Reverse transcription-polymerase chain reaction
NF-κB:Nuclear factor-κB
STAT3:Signal transducer and activator of transcription 3
PYK2:Proline-rich tyrosine kinase 2.

Data Availability

The data used to support the findings of this study are available from the corresponding author upon request.

Conflicts of Interest

The authors declare no conflicts of interest.

Acknowledgments

This research was supported by the Drug Innovation Major Project (2018ZX09711-001), National Natural Science Foundation of China (81673570 and 81903889), Shanghai Science and Technology Innovation Action Plan (18401931100), Shanghai Sailing Program (19YF1449100), Budgeted Research Project in Shanghai University of Traditional Chinese Medicine (2019LK071), and program of Shanghai E-research Institute of Bioactive Constituents in Traditional Chinese Medicine.

Supplementary Materials

After LPS stimulation, the phosphorylation of JAK2 was at the edge of the lowest detection limit, and there was no statistical difference between treatment with LPS or no treatment in THP-1 cells. (Supplementary Materials)

References

  1. C. D. Buckley, F. Barone, S. Nayar, C. Bénézech, and J. Caamaño, “Stromal cells in chronic inflammation and tertiary lymphoid organ formation,” Annual Review of Immunology, vol. 33, no. 1, pp. 715–745, 2015. View at: Publisher Site | Google Scholar
  2. I. E. Lundberg, “The role of cytokines, chemokines, and adhesion molecules in the pathogenesis of idiopathic inflammatory myopathies,” Current Rheumatology Reports, vol. 2, no. 3, pp. 216–224, 2000. View at: Publisher Site | Google Scholar
  3. T. A. Wynn, A. Chawla, and J. W. Pollard, “Macrophage biology in development, homeostasis and disease,” Nature, vol. 496, no. 7446, pp. 445–455, 2013. View at: Publisher Site | Google Scholar
  4. J. G. Bode, C. Ehlting, and D. Häussinger, “The macrophage response towards LPS and its control through the p38MAPK-STAT3 axis,” Cellular Signalling, vol. 24, no. 6, pp. 1185–1194, 2012. View at: Publisher Site | Google Scholar
  5. O. Takeuchi and S. Akira, “Pattern recognition receptors and inflammation,” Cell, vol. 140, no. 6, pp. 805–820, 2010. View at: Publisher Site | Google Scholar
  6. A. M. Piccinini, L. Zuliani-Alvarez, J. M. P. Lim, and K. S. Midwood, “Distinct microenvironmental cues stimulate divergent TLR4-mediated signaling pathways in macrophages,” Science Signaling, vol. 9, no. 443, p. ra86, 2016. View at: Publisher Site | Google Scholar
  7. V. Costantino, E. Fattorusso, A. Mangoni et al., “Tedanol: a potent anti-inflammatory ent-pimarane diterpene from the Caribbean Sponge Tedania ignis,” Bioorganic & Medicinal Chemistry, vol. 17, no. 21, pp. 7542–7547, 2009. View at: Publisher Site | Google Scholar
  8. S. Mizokami Sandra, S. N. Hohmann Miriam, L. Staurengo-Ferrari et al., “Pimaradienoic acid inhibits carrageenan-induced inflammatory leukocyte recruitment and edema in mice: inhibition of oxidative stress, nitric oxide and cytokine production,” PLoS One, vol. 11, no. 2, Article ID e0149656, 2016. View at: Publisher Site | Google Scholar
  9. R. Tanaka, H. Tokuda, and Y. Ezaki, “Cancer chemopreventive activity of “rosin” constituents of Pinus spez. and their derivatives in two-stage mouse skin carcinogenesis test,” Phytomedicine, vol. 15, no. 11, pp. 985–992, 2008. View at: Publisher Site | Google Scholar
  10. E. Adou, R. B. Williams, J. K. Schilling et al., “Cytotoxic diterpenoids from two lianas from the Suriname rainforest,” Bioorganic & Medicinal Chemistry, vol. 13, no. 21, pp. 6009–6014, 2005. View at: Publisher Site | Google Scholar
  11. Y.-D. Zheng, G. Xing-Chen, L. Dan et al., “Novel diterpenoids from the twigs of Podocarpus nagi,” Molecules, vol. 21, no. 10, p. 1282, 2016. View at: Publisher Site | Google Scholar
  12. T. Porto, R. Rangel, N. Furtado et al., “Pimarane-type diterpenes: antimicrobial activity against oral pathogens,” Molecules, vol. 14, no. 1, pp. 191–199, 2009. View at: Publisher Site | Google Scholar
  13. U. V. Hipólito, G. J. Rodrigues, C. N. Lunardi et al., “Mechanisms underlying the vasorelaxant action of the pimarane ent-8(14),15-pimaradien-3β-ol in the isolated rat aorta,” European Journal of Pharmacology, vol. 616, no. 1-3, pp. 183–191, 2009. View at: Publisher Site | Google Scholar
  14. P. Reveglia, A. Cimmino, M. Masi et al., “Pimarane diterpenes: natural source, stereochemical configuration, and biological activity,” Chirality, vol. 30, no. 10, pp. 1115–1134, 2018. View at: Publisher Site | Google Scholar
  15. H.-B. Yu, X.-L. Wang, W.-H. Xu et al., “Eutypellenoids A–C., new pimarane diterpenes from the arctic fungus Eutypella sp. D-1,” Marine Drugs, vol. 16, no. 8, p. 284, 2018. View at: Publisher Site | Google Scholar
  16. M. T. T. Nguyen, S. Awale, Y. Tezuka, C. Chien-Hsiung, and S. Kadota, “Staminane-and isopimarane-type diterpenes from Orthosiphon stamineus of Taiwan and their nitric oxide inhibitory activity,” Journal of Natural Products, vol. 67, no. 4, pp. 654–658, 2004. View at: Publisher Site | Google Scholar
  17. Y.-G. Suh, Y.-H. Kim, M.-H. Park et al., “Pimarane cyclooxygenase 2 (COX-2) inhibitor and its structure-activity relationship,” Bioorganic & Medicinal Chemistry Letters, vol. 11, no. 4, pp. 559–562, 2001. View at: Publisher Site | Google Scholar
  18. L. Ni, Z. Zhao, G. Dorje, and M. Ma, “The complete chloroplast genome of Ye-Xing-Ba (Scrophularia dentata; Scrophulariaceae), an alpine Tibetan herb,” PLoS One, vol. 11, no. 7, Article ID e0158488, 2016. View at: Publisher Site | Google Scholar
  19. L. Zhang, T. Zhu, F. Qian et al., “Iridoid glycosides isolated from Scrophularia dentata Royle ex Benth. and their anti-inflammatory activity,” Fitoterapia, vol. 98, pp. 84–90, 2014. View at: Publisher Site | Google Scholar
  20. L. Zhang, D. Zhang, Q. Jia et al., “19(4 ⟶ 3)-abeo-abietane diterpenoids from Scrophularia dentata Royle ex Benth,” Fitoterapia, vol. 106, pp. 72–77, 2015. View at: Publisher Site | Google Scholar
  21. T. Zhu, L. Zhang, S. Ling et al., “Scropolioside B inhibits IL-1β and cytokines expression through NF-κB and inflammasome NLRP3 pathways,” Mediators of Inflammation, vol. 2014, Article ID 819053, 10 pages, 2014. View at: Publisher Site | Google Scholar
  22. F. Qian, L. Zhang, S. Lu et al., “Scrodentoid A inhibits mast cell-mediated allergic response by blocking the lyn-FcεRIβ interaction,” Frontiers in Immunology, vol. 10, Article ID 1103, 2019. View at: Publisher Site | Google Scholar
  23. W. Chanput, J. J. Mes, and H. J. Wichers, “THP-1 cell line: an in vitro cell model for immune modulation approach,” International Immunopharmacology, vol. 23, no. 1, pp. 37–45, 2014. View at: Publisher Site | Google Scholar
  24. M. Gutiérrez, R. Santamaría, J. F. Gómez-Reyes et al., “New eunicellin-type diterpenes from the panamanian octocoral Briareum asbestinum,” Marine Drugs, vol. 18, no. 2, p. 84, 2020. View at: Publisher Site | Google Scholar
  25. W. Guo, Y. Sun, W. Liu et al., “Small molecule-driven mitophagy-mediated NLRP3 inflammasome inhibition is responsible for the prevention of colitis-associated cancer,” Autophagy, vol. 10, no. 6, pp. 972–985, 2014. View at: Publisher Site | Google Scholar
  26. S. Ma, D. Zhang, H. Lou, L. Sun, and J. Ji, “Evaluation of the anti-inflammatory activities of tanshinones isolated from Salvia miltiorrhiza var. alba roots in THP-1 macrophages,” Journal of Ethnopharmacology, vol. 188, pp. 193–199, 2016. View at: Publisher Site | Google Scholar
  27. P. G. Través, M. Pimentel-Santillana, D. Rico et al., “Anti-inflammatory actions of acanthoic acid-related diterpenes involve activation of the PI3K p110γ/δ subunits and inhibition of NF-κB,” Chemistry & Biology, vol. 21, no. 8, pp. 955–966, 2014. View at: Publisher Site | Google Scholar
  28. D. Thummuri, L. Guntuku, V. S. Challa, R. N. Ramavat, and V. G. M. Naidu, “Abietic acid attenuates RANKL induced osteoclastogenesis and inflammation associated osteolysis by inhibiting the NF-KB and MAPK signaling,” Journal of Cellular Physiology, vol. 234, no. 1, pp. 443–453, 2018. View at: Publisher Site | Google Scholar
  29. H. Jayasuriya, K. B. Herath, J. G. Ondeyka et al., “Diterpenoid, steroid, and triterpenoid agonists of liver X receptors from diversified terrestrial plants and marine sources,” Journal of Natural Products, vol. 68, no. 8, pp. 1247–1252, 2005. View at: Publisher Site | Google Scholar
  30. B. Las Heras, B. Rodríguez, L. Boscá, and A. Villar, “Terpenoids: sources, structure elucidation and therapeutic potential in inflammation,” Current Topics in Medicinal Chemistry, vol. 3, no. 2, pp. 171–185, 2003. View at: Publisher Site | Google Scholar
  31. C. A. Dinarello, “A clinical perspective of IL-1β as the gatekeeper of inflammation,” European Journal of Immunology, vol. 41, no. 5, pp. 1203–1217, 2011. View at: Publisher Site | Google Scholar
  32. M. L. Schmitz, A. Weber, T. Roxlau, M. Gaestel, and M. Kracht, “Signal integration, crosstalk mechanisms and networks in the function of inflammatory cytokines,” Biochimica et Biophysica Acta (BBA)—Molecular Cell Research, vol. 1813, no. 12, pp. 2165–2175, 2011. View at: Publisher Site | Google Scholar
  33. J. S. C. Arthur and S. C. Ley, “Mitogen-activated protein kinases in innate immunity,” Nature Reviews Immunology, vol. 13, no. 9, pp. 679–692, 2013. View at: Publisher Site | Google Scholar
  34. S. K. Ha, E. Moon, and S. Y. Kim, “Chrysin suppresses LPS-stimulated proinflammatory responses by blocking NF-κB and JNK activations in microglia cells,” Neuroscience Letters, vol. 485, no. 3, pp. 143–147, 2010. View at: Publisher Site | Google Scholar
  35. R. L. Zemans and P. G. Arndt, “Tec kinases regulate actin assembly and cytokine expression in LPS-stimulated human neutrophils via JNK activation,” Cellular Immunology, vol. 258, no. 1, pp. 90–97, 2009. View at: Publisher Site | Google Scholar
  36. S. Jang, K. W. Kelley, and R. W. Johnson, “Luteolin reduces IL-6 production in microglia by inhibiting JNK phosphorylation and activation of AP-1,” Proceedings of the National Academy of Sciences, vol. 105, no. 21, pp. 7534–7539, 2008. View at: Publisher Site | Google Scholar
  37. D. Morse, S. E. Pischke, Z. Zhou et al., “Suppression of inflammatory cytokine production by carbon monoxide involves the JNK pathway and AP-1,” Journal of Biological Chemistry, vol. 278, no. 39, pp. 36993–36998, 2003. View at: Publisher Site | Google Scholar
  38. H. Yu, D. Pardoll, and R. Jove, “STATs in cancer inflammation and immunity: a leading role for STAT3,” Nature Reviews Cancer, vol. 9, no. 11, pp. 798–809, 2009. View at: Publisher Site | Google Scholar
  39. A. V. Villarino, Y. Kanno, J. R. Ferdinand, and J. J. O’Shea, “Mechanisms of Jak/STAT signaling in immunity and disease,” The Journal of Immunology, vol. 194, no. 1, pp. 21–27, 2015. View at: Publisher Site | Google Scholar
  40. M.-Y. Gu, Y. S. Chun, D. Zhao, S. Y. Ryu, and H. O. Yang, “Glycyrrhiza uralensis and semilicoisoflavone B reduce Aβ secretion by increasing PPARγ expression and inhibiting STAT3 phosphorylation to inhibit BACE1 expression,” Molecular Nutrition & Food Research, vol. 62, no. 6, Article ID e1700633, 2018. View at: Publisher Site | Google Scholar
  41. G. He and M. Karin, “NF-κB and STAT3—key players in liver inflammation and cancer,” Cell Research, vol. 21, no. 1, pp. 159–168, 2011. View at: Publisher Site | Google Scholar
  42. P. M. Nguyen, T. L. Putoczki, and M. Ernst, “STAT3-activating cytokines: a therapeutic opportunity for inflammatory bowel disease?” Journal of Interferon & Cytokine Research, vol. 35, no. 5, pp. 340–350, 2015. View at: Publisher Site | Google Scholar
  43. A. V. Nguyen, Y.-Y. Wu, Q. Liu et al., “STAT3 in epithelial cells regulates inflammation and tumor progression to malignant state in colon,” Neoplasia, vol. 15, no. 9, pp. 998–1008, 2013. View at: Publisher Site | Google Scholar
  44. A. M. F. Liu, R. K. H. Lo, C. S. S. Wong, C. Morris, H. Wise, and Y. H. Wong, “Activation of STAT3 by Gαs distinctively requires protein kinase A, JNK, and phosphatidylinositol 3-kinase,” Journal of Biological Chemistry, vol. 281, no. 47, pp. 35812–35825, 2006. View at: Publisher Site | Google Scholar
  45. X. Li, D. Wang, Z. Chen et al., “Gαi1 and Gαi3 regulate macrophage polarization by forming a complex containing CD14 and Gab1,” Proceedings of the National Academy of Sciences, vol. 112, no. 15, pp. 4731–4736, 2015. View at: Publisher Site | Google Scholar
  46. A. Lentschat, H. Karahashi, K. S. Michelsen et al., “Mastoparan, a G protein agonist peptide, differentially modulates TLR4- and TLR2-mediated signaling in human endothelial cells and murine macrophages,” The Journal of Immunology, vol. 174, no. 7, pp. 4252–4261, 2005. View at: Publisher Site | Google Scholar
  47. H. Ying, L. Da, S. Yu-Xiu et al., “TLR4 mediates MAPK-STAT3 axis activation in bladder epithelial cells,” Inflammation, vol. 36, no. 5, pp. 1064–1074, 2013. View at: Publisher Site | Google Scholar
  48. J.-J. Cheng, Y.-J. Chao, and D. L. Wang, “Cyclic strain activates redox-sensitive proline-rich tyrosine kinase 2 (PYK2) in endothelial cells,” Journal of Biological Chemistry, vol. 277, no. 50, pp. 48152–48157, 2002. View at: Publisher Site | Google Scholar
  49. C.-S. Shi and J. H. Kehrl, “Pyk2 amplifies epidermal growth factor and c-Src-induced Stat3 activation,” Journal of Biological Chemistry, vol. 279, no. 17, pp. 17224–17231, 2004. View at: Publisher Site | Google Scholar
  50. M. Murphy James, K. Jeong, A. R. Rodriguez Yelitza, J.-H. Kim, E.-Y. Erin Ahn, and S.-T. Steve Lim, “FAK and Pyk2 activity promote TNF-α and IL-1β-mediated pro-inflammatory gene expression and vascular inflammation,” Scientific Reports, vol. 9, no. 1, Article ID 7617, 2019. View at: Publisher Site | Google Scholar
  51. P. Jennifer, M. Gosset, C. Gayl et al., “CCL2/CCL5 secreted by the stroma induce IL-6/PYK2 dependent chemoresistance in ovarian cancer,” Molecular Cancer, vol. 17, no. 1, p. 47, 2018. View at: Publisher Site | Google Scholar
  52. E. Revuelta-López, J. Castellano, S. Roura et al., “Hypoxia induces metalloproteinase-9 activation and human vascular smooth muscle cell migration through low-density lipoprotein receptor-related protein 1-mediated Pyk2 phosphorylation,” Arteriosclerosis, Thrombosis, and Vascular Biology, vol. 33, no. 12, pp. 2877–2887, 2013. View at: Publisher Site | Google Scholar
  53. M. M. K. Lee, R. K. S. Chui, I. Y. S. Tam, A. H. Y. Lau, and Y. H. Wong, “CCR1-mediated STAT3 tyrosine phosphorylation and CXCL8 expression in THP-1 macrophage-like cells involve pertussis toxin-insensitive Gα(14/16) signaling and IL-6 release,” The Journal of Immunology, vol. 189, no. 11, pp. 5266–5276, 2012. View at: Publisher Site | Google Scholar
  54. M. Jougasaki, T. Ichiki, Y. Takenoshita, and M. Setoguchi, “Statins suppress interleukin-6-induced monocyte chemo-attractant protein-1 by inhibiting Janus kinase/signal transducers and activators of transcription pathways in human vascular endothelial cells,” British Journal of Pharmacology, vol. 159, no. 6, pp. 1294–1303, 2010. View at: Publisher Site | Google Scholar
  55. E. Feigerlová and S.-F. Battaglia-Hsu, “IL-6 signaling in diabetic nephropathy: from pathophysiology to therapeutic perspectives,” Cytokine & Growth Factor Reviews, vol. 37, pp. 57–65, 2017. View at: Publisher Site | Google Scholar
  56. M. Szelag, A. Piaszyk-Borychowska, M. Plens-Galaska, J. Wesoly, and H. A. R. Bluyssen, “Targeted inhibition of STATs and IRFs as a potential treatment strategy in cardiovascular disease,” Oncotarget, vol. 7, no. 30, pp. 48788–48812, 2016. View at: Publisher Site | Google Scholar
  57. A. Goropevšek, M. Holcar, and T. Avčin, “The role of STAT signaling pathways in the pathogenesis of systemic lupus erythematosus,” Clinical Reviews in Allergy & Immunology, vol. 52, no. 2, pp. 164–181, 2017. View at: Publisher Site | Google Scholar
  58. H. Mühl, “STAT3, a key parameter of cytokine-driven tissue protection during sterile inflammation—the case of experimental acetaminophen (paracetamol)-induced liver damage,” Frontiers in Immunology, vol. 7, Article ID 163, 2016. View at: Publisher Site | Google Scholar
  59. M. Kurdi, C. Zgheib, and G. W. Booz, “Recent developments on the crosstalk between STAT3 and inflammation in heart function and disease,” Frontiers in Immunology, vol. 9, Article ID 3029, 2018. View at: Publisher Site | Google Scholar
  60. C. Garbers, S. Aparicio-Siegmund, and S. Rose-John, “The IL-6/gp130/STAT3 signaling axis: recent advances towards specific inhibition,” Current Opinion in Immunology, vol. 34, pp. 75–82, 2015. View at: Publisher Site | Google Scholar
  61. E. Guadagnin, D. Mázala, and Y. W. Chen, “STAT3 in skeletal muscle function and disorders,” International Journal of Molecular Sciences, vol. 19, no. 8, Article ID 2265, 2018. View at: Publisher Site | Google Scholar
  62. M. Leppkes, M. F. Neurath, M. Herrmann, and C. Becker, “Immune deficiency vs. immune excess in inflammatory bowel diseases-STAT3 as a rheo-STAT of intestinal homeostasis,” Journal of Leukocyte Biology, vol. 99, no. 1, pp. 57–66, 2016. View at: Publisher Site | Google Scholar

Copyright © 2020 Gaohui Mao et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


More related articles

 PDF Download Citation Citation
 Download other formatsMore
 Order printed copiesOrder
Views74
Downloads57
Citations

Related articles

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.