Evidence-Based Complementary and Alternative Medicine / 2020 / Article / Tab 3

Research Article

Luhong Formula Has a Cardioprotective Effect on Left Ventricular Remodeling in Pressure-Overloaded Rats

Table 3

Forward and reverse primer sequences used for real-time PCR.

GeneForwardReverse

eNOS5′CTTTCGGAAGGCGTTTGAC3′5′AACTCTTGTGCTGCTCAGG3′
COL1A15′TCAAGATGTGCCACTCTG3′5′ACCTTCGCTTCCATACTC3′
COL3A15′GTCCACAGCCTTCTACAC3′5′TCCGACTCCAGACTTGAC3′
TGF-β15′AAGGACCTGGGTTGGAAGTG3′5′TGGTTGTAGAGGGCAAGGAC3′
VEGF5′GAGTCTGTGCTCTGGGATTTG3′5′TCCTGCTACCTCTTTCCTCTG3′
VEGFR25′TTACTGTCCAGCCTGCTAC3′5′CCAAAGAGCGTCCAAGTTC3′
GAPDH5′GTCGGTGTGAACGGATTTG3′5′TCCCATTCTCAGCCTTGAC3′

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.