Evidence-Based Complementary and Alternative Medicine / 2020 / Article / Tab 1

Research Article

Curcumin Regulates ERCC1 Expression and Enhances Oxaliplatin Sensitivity in Resistant Colorectal Cancer Cells through Its Effects on miR-409-3p

Table 1

Primer sequences.

PrimerPrimer sequence (5′-3′)Length/bp

ERCC1Forward primer (5′ ⟶ 3′)ATGTCTGACCACCGTGAA188
Reverse primer (5′ ⟶ 3′)TGTTCCAGAGATCCAAATGTG
Bcl-2Forward primer (5′ ⟶ 3′)GCCTTCTTTGAGTTCGGTG83
Reverse primer (5′ ⟶ 3′)AGTCATCCACAGGGCGAT
GST-πForward primer (5′ ⟶ 3′)CAGGAGGGTCACTCAAAG437
Reverse primer (5′ ⟶ 3′)CAGGTTGTAGTCAGCGAAG
MRP1Forward primer (5′ ⟶ 3′)GGCATCTCAGCAACTCGTCTT250
Reverse primer (5′ ⟶ 3′)ATTAGCTTCCACGTCTCCTCCTT
p-gp (MDR1)Forward primer (5′ ⟶ 3′)AGCTCATCGTTTGTCTACAGTTCG403
Reverse primer (5′ ⟶ 3′)TCCACGGACACTCCTACGAGT
SurvivinForward primer (5′ ⟶ 3′)AAGAACTGGCCCTTCTTGGA313
Reverse primer (5′ ⟶ 3′)CAACCGGACGAATGCTTTT
β-ActinForward primer (5′ ⟶ 3′)CATGTACGTTGCTATCCAGGC268
Reverse primer (5′ ⟶ 3′)CTCCTTAATGTCACGCACGAT

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.