Genetics Research International / 2014 / Article / Tab 1

Research Article

Expression of Potential Regulatory Genes in Abdominal Adipose Tissue of Broiler Chickens during Early Development

Table 1

Primers used for RT-qPCR analysis of gene expression.

Accession numberGene Forward sequence (5′) Reverse sequence (3′)Amplicon size (bp)

NW_003763826IGFBP2TGTGACAAGCATGGCTTGTACATCCACGCTGCCCATTCA62
NM_204978.1GREM1CCATGAAGAAGGCTGCAACATGCATTGGCCATAGCAGAAC58
NM_205509.2FGFR3GCTGATTT TGGCCTTGCTAGAGGCAGCCGACCATTGGT70
NW_003763661ACBD7AGATGTGAAAGGCAAAGCCAAATCATGGCATCCTCCTTCGAT70
NM_205380COL3A1TTGTTCATTCTTGCCGTGTTTCTCCTCCTAGGGCGTCCTGTT62
M20816TNCCTGAGCAGATCTATGAGGAGCAAAGGATAAGGATAAAGAAGACCAGTTGTG70
NM_206951EPHB2CATGCCATGCACCACCATTTTCATTCACGCTGGAGATCAC58
NW_003763812SCDGCGCTGCTCACATGTTTGGTCTCCCGTGGGTTGATGTTC56

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19.