SOD1 Gene +35A/C (exon3/intron3) Polymorphism in Type 2 Diabetes Mellitus among South Indian Population

Nithya, K.; Angeline, T.; Isabel, W.; Asirvatham, A. J.

doi:https://doi.org/10.1155/2016/3787268

Genetics Research International

On this page

Abstract Introduction Materials and Methods Results and Discussion Conclusions References Copyright Related Articles

Research Article | Open Access

Volume 2016 | Article ID 3787268 | https://doi.org/10.1155/2016/3787268

SOD1 Gene +35A/C (exon3/intron3) Polymorphism in Type 2 Diabetes Mellitus among South Indian Population

K. Nithya,¹T. Angeline,¹W. Isabel,¹and A. J. Asirvatham²

Academic Editor: Norman A. Doggett

Received30 Nov 2015

Accepted17 Feb 2016

Published17 Apr 2016

Abstract

Superoxide dismutase is an antioxidant enzyme that is involved in defence mechanisms against oxidative stress. Cu/Zn SOD is a variant that is located in exon3/intron3 boundary. The aim of the present study was to investigate whether the Cu/Zn SOD (+35A/C) gene polymorphism is associated with the susceptibility to type 2 diabetes mellitus among south Indian population. The study included patients with type 2 diabetes mellitus () and healthy controls (). DNA was isolated from the blood and genotyping of Cu/Zn SOD gene polymorphism was done by polymerase chain reaction based restriction fragment length polymorphism method. Occurrence of different genotypes and normal (A) and mutant (C) allele frequencies were determined. The frequency of the three genotypes of the total subjects was as follows: homozygous wild-type A/A (95%), heterozygous genotype A/C (3%), and homozygous mutant C/C (2%). The mutant (C) allele and the mutant genotypes (AC/CC) were found to be completely absent among the patients with type 2 diabetes mellitus. Absence of mutant genotype (CC) shows that the Cu/Zn SOD gene polymorphism may not be associated with the susceptibility to type 2 diabetes mellitus among south Indian population.

1. Introduction

Diabetes mellitus is a polygenic metabolic disease characterized by hyperglycemia resulting from defects in both insulin secretion and its action [1]. Both the genetic and the environmental factors are involved in the development of type 2 diabetes mellitus [2]. Oxidative stress and oxidative damage to the tissue are common end points of chronic diseases, such as atherosclerosis, diabetes, and rheumatoid arthritis [3]. It has been demonstrated that oxidative stress in diabetes can be accelerated not only due to increased production of reactive oxygen species (ROS) caused by hyperglycaemia but also by reduced ability of antioxidant defense system caused at least partly by polymorphisms of scavenger enzymes like superoxide dismutase, catalase, and reduced glutathione [4]. Superoxide dismutase (SOD) is considered as a primary enzyme since it is involved in the direct elimination of reactive oxygen species [5]. In mammals, there are 3 isoforms of SOD, copper-zinc SOD (SOD1), manganese SOD (SOD2), and an extracellular form of CuZn-SOD (EC-SOD or SOD3). Each superoxide dismutase is the product of distinct genes but catalyzes the same reaction [6]:Among the 3 isoforms, experimental evidences from mice indicate that activity of CuZn-SOD accounts for 50% to 80% of total SOD activity. Mn-SOD accounts for approximately 2% to 12% of total vascular SOD, and EC-SOD accounts for the remainder [7]. SOD1 [] has a molecular mass of about 32,000 Da and has been found in the cytoplasm, nuclear compartments, and lysosomes of mammalian cells [8]. The SOD1 gene has been extensively studied and DNA sequence changes in the gene can be detected in about 0.3% of humans worldwide [9]. It has been hypothesized that mutations in the SOD1 gene may impair antioxidant enzyme activity thereby leading to accumulation of toxic superoxide anions [10].

SOD1 gene has five exons and the +35A/C polymorphism (rs2234694) is adjacent to the splicing point (exon3/intron3), being related to macrovascular complications in diabetes and having no association with microvascular complications [4]. While data regarding the SOD1 (+35A/C) gene polymorphism is available for other populations, including North Indians, the Bangladeshi, the Finns, the Romanians, the New Zealanders, and the Czechs [4, 11–15], it is lacking among South Indian population. Therefore, the present study has been conducted to determine the prevalence of +35A/C polymorphism in intron3/exon3 boundary of the SOD1 gene among South Indian population. In addition, the genetic association between polymorphism in the (+35A/C) SOD1 gene and type 2 diabetes mellitus has also been studied.

2. Materials and Methods

2.1. Study Design

The study population consisted of seventy-five controls with no history of cardiovascular disease, diabetes, hypertension, cancer, or any infectious diseases and one hundred patients with type 2 diabetes mellitus, belonging to South Indian population. The patients included were characterized based on the alteration in blood sugar level (>126 mg/dL). The samples from the subjects were collected into EDTA coated tubes and the informed consent was obtained. Clinical data including information on duration of diabetes, presence of any complication, history of other disorders, age, gender, lipid profile, blood sugar level, and systolic and diastolic blood pressure were collected using a questionnaire. Ethical clearance was obtained for this study.

2.1.1. DNA Extraction

Genomic DNA was extracted from the frozen blood by phenol-chloroform method [16]. For DNA extraction, 500 μL of the blood was used and the isolated DNA dissolved in TE was stored at −20°C. The quality of the DNA was checked in 0.7 percent agarose (Hi-Media, Mumbai) gel electrophoresis and quantified using UV spectrophotometry (Hitachi, Japan).

2.1.2. PCR Analysis of SOD1 (+35A/C) Gene [17]

PCR analysis was carried out using a thermal cycler (Eppendorf Mastercycler, Germany). Approximately 120 ng of genomic DNA was incubated in a total reaction mixture of 20 μL containing both the forward primer 5′ CTATCCAGAAAACACGGTGGGCC 3′ and the reverse primer 5′ TCTATATTCAATCAAATGCTACAAAACC 3′ (~10 picomoles) (GenScript Corp., USA), 200 μM deoxynucleotide triphosphate, 10x PCR buffer pH-8.3 containing MgCl₂ 15 mM, and 5 units of Taq DNA polymerase (New England Biolabs, Beverly). DNA was initially denatured at 95°C for 8 min prior to amplification. The PCR amplification conditions were as follows: 30 cycles consisting of 1 min denaturation at 94°C, 50 sec annealing at 64°C, and 1 min extension at 72°C. The final extension included 7 mins at 72°C. The PCR product (278 bp) was confirmed by 2% agarose (Hi-Media, Mumbai) gel electrophoresis. The amplified product was used for further restriction fragment analysis.

2.1.3. Restriction Enzyme Analysis [17]

Restriction digestion was performed in a total volume of 20 μL consisting of 10 μL amplicon, 4 μL NE buffer (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, and 1 mM dithiothreitol pH-7.9 at 25°C), and 10 U of HhaI enzyme (Fermentas Life Sciences, Germany). Samples were incubated for 6-7 hrs at 37°C and the digested PCR products were resolved in 2 percent agarose gel electrophoresis stained with ethidium bromide and separated bands were observed using gel documentation system. PCR-RFLP analysis revealed the existence of the three genotypes (AA, AC, and CC) of +35A/C SOD1 gene polymorphism.

2.1.4. Sequencing of the PCR Amplified Product

The PCR product obtained was subjected to DNA sequencing which was carried out by Sanger’s sequencing method (Synergy Scientific Services, Chennai) [18]. The DNA sequencing was done to check and confirm whether the amplified product was SOD1 gene sequence. The obtained sequence was then subjected to BLASTN analysis to study the homology sequence of the amplified product.

3. Results and Discussion

The clinical data including the risk factors of study subjects are shown in Table 1. A 278 bp fragment that resides in the SOD1 gene was amplified (Figure 1) and sequenced. When BLASTN analysis was performed with the DNA sequence of PCR product (278 bp), 100 percent homology was found between the SOD1 gene and the submitted DNA sequence. After digesting the PCR amplicons with HhaI, the following fragment sizing patterns were observed by the gel electrophoresis: the SOD1 +35A/A genotype resulted in no cleavage of the amplified 278 bp fragments and the A/C genotype resulted in 3 fragments of 278, 207, and 71 bp. C/C genotype resulted in complete cleavage of the 278 bp fragment into 207 and 71 bp (Figure 2).

(a)

(b)

Genotype and allelic frequencies for the +35A/C SNP of the SOD1 gene in diabetic patients and nondiabetic healthy individuals were calculated. The results indicated that the occurrence of homozygous mutant (CC) and heterozygous mutant (AC) was completely absent in type 2 diabetes mellitus patients whereas such condition was observed in 4 (5%) and 6 (8%) of the controls (Table 2). As the two genotypes were completely absent in type 2 diabetes mellitus patients, Hardy-Weinberg equilibrium was not tested. The A allele frequency was found to be 1.0 for diabetic patients and 0.91 for controls. The C allele frequency was completely absent in patients when compared to controls (0.09), which indicates that the Cu/Zn SOD gene polymorphism may not be associated with the susceptibility to type 2 diabetes mellitus among South Indian population.

Similar result was observed in a study conducted among Finnish population that there is no difference in the genotype distributions and allele frequencies of the CuZn-SOD gene polymorphism between type 2 diabetes mellitus patients and controls [13]. Another study has also reported that the (CC) genotype and C allele were completely absent among North Indian population and that there is no association between diabetes and SOD1 +35A/C gene polymorphism [11]. However, contradictory results indicating that there is an association between diabetes and SOD1 +35A/C gene polymorphism were obtained in a study conducted among Bangladeshi population [12]. Similarly, Panduru et al. provided evidences that there is an association of SOD1 +35A/C gene polymorphism with diabetic nephropathy in Romanian population [14]. When the prevalence of the SOD1 +35A/C gene polymorphism among South Indian Tamil population was determined and the association of the mutant allele with type 2 diabetes mellitus was evaluated, no association was found between SOD1 +35A/C gene polymorphism and type 2 diabetes mellitus.

As allele frequencies are population specific, there is variation in allelic frequencies in different population (Table 3). The highest mutant allele frequency of SOD1 +35A/C gene polymorphism was observed among Czechs (0.4) and the lowest (0.018) was observed among South Indian population.

Both genetic and biochemical characterization of SOD1 [19] demonstrates that SOD1 gains importance in the development of diseases such as heart failure [20], cancer [21], diabetes [4], Down’s syndrome [22], and amyotrophic lateral sclerosis [23]. It has been reported that the SOD’s involvement in the pathogenesis of diseases is due to altered SOD activity and ROS concentration [24]. It was also found that the SOD1 gene polymorphism influences SOD activity [25]. Decreased activity of the antioxidant enzymes and depletion of total antioxidant capacity may increase the susceptibility of diabetic patients to oxidative injury [26]. Similarly, studies conducted by Sayed et al. and Fujita et al. have reported that the enzymatic activity of SOD was significantly decreased in diabetic patients with retinopathy [27] and nephropathy [28]. Clinical studies conducted in different populations have shown a decrease in SOD activity in type 2 diabetic patients when compared to controls [29, 30].

4. Conclusions

As the mutant genotype and allele frequency were completely absent in type 2 diabetic patients among South Indian population, it was concluded that the CuZn-SOD (+35A/C) gene polymorphism may not be associated with the susceptibility to type 2 diabetes mellitus. However, this lack of association might be due to smaller sample size and ethnic variation. Further study is needed to investigate the other SNPs (Mn-SOD and EC-SOD) in SOD gene to elicit the potential role of antioxidant defense and susceptibility in type 2 diabetes mellitus.

Conflict of Interests

The authors have no conflict of interests in this paper.

Acknowledgment

The authors thank the Science and Engineering Research Board (SERB), New Delhi, India, for funding to Dr. T. Angeline.

References

J. R. Gavin, K. G. M. M. Alberti, M. B. Davidson et al., “Report of the expert committee on the diagnosis and classification of diabetes mellitus,” Diabetes Care, vol. 26, no. 1, pp. 1183–1197, 2003.
View at: Publisher Site | Google Scholar
D. Giugliano, A. Ceriello, and K. Esposito, “Glucose metabolism and hyperglycemia,” The American Journal of Clinical Nutrition, vol. 87, no. 1, pp. 217–222, 2008.
View at: Google Scholar
J. W. Baynes and S. R. Thorpe, “Role of oxidative stress in diabetic complications: a new perspective on an old paradigm,” Diabetes, vol. 48, no. 1, pp. 1–9, 1999.
View at: Publisher Site | Google Scholar
M. Flekac, J. Skrha, J. Hilgertova, Z. Lacinova, and M. Jarolimkova, “Gene polymorphisms of superoxide dismutases and catalase in diabetes mellitus,” BMC Medical Genetics, vol. 9, article 30, 2008.
View at: Publisher Site | Google Scholar
J. M. McCord, B. B. Keele Jr., and I. Fridovich, “An enzyme-based theory of obligate anaerobiosis: the physiological function of superoxide dismutase,” Proceedings of the National Academy of Sciences of the United States of America, vol. 68, no. 5, pp. 1024–1027, 1971.
View at: Publisher Site | Google Scholar
F. M. Faraci and S. P. Didion, “Vascular protection: superoxide dismutase isoforms in the vessel wall,” Arteriosclerosis, Thrombosis, and Vascular Biology, vol. 24, no. 8, pp. 1367–1373, 2004.
View at: Publisher Site | Google Scholar
P. Stralin, K. Karlsson, B. O. Johansson, and S. L. Marklund, “The interstitium of the human arterial wall contains very large amounts of extracellular superoxide dismutase,” Arteriosclerosis, Thrombosis, and Vascular Biology, vol. 15, no. 11, pp. 2032–2036, 1995.
View at: Publisher Site | Google Scholar
W. Liou, L.-Y. Chang, H. J. Geuze, G. J. Strous, J. D. Crapo, and J. W. Slot, “Distribution of CuZn superoxide dismutase in rat liver,” Free Radical Biology and Medicine, vol. 14, no. 2, pp. 201–207, 1993.
View at: Publisher Site | Google Scholar
P. M. Andersen, K. B. Sims, W. W. Xin et al., “Sixteen novel mutations in the Cu/Zn superoxide dismutase gene in amyotrophic lateral sclerosis: a decade of discoveries, defects and disputes,” Amyotrophic Lateral Sclerosis and Other Motor Neuron Disorders, vol. 4, no. 2, pp. 62–73, 2003.
View at: Publisher Site | Google Scholar
M. E. Gurney, H. Pu, A. Y. Chiu et al., “Motor neuron degeneration in mice that express a human Cu,Zn superoxide dismutase mutation,” Science, vol. 264, no. 5166, pp. 1772–1774, 1994.
View at: Publisher Site | Google Scholar
P. Vats, N. Sagar, T. P. Singh, and M. Banerjee, “Association of Superoxide dismutases (SOD1 and SOD2) and Glutathione peroxidase 1 (GPx1) gene polymorphisms with Type 2 diabetes mellitus,” Free Radical Research, vol. 49, no. 1, pp. 17–24, 2015.
View at: Publisher Site | Google Scholar
L. A. Akhy, P. Deb, M. Das, L. Ali, M. Omar Faruque, and Z. Hassan, “Superoxide dismutase 1 gene +35A>C (intron3/exon3) polymorphism in diabetic nephropathy patients among Bangladeshi population,” Journal of Molecular Pathophysiology, vol. 3, no. 4, pp. 52–57, 2014.
View at: Google Scholar
O. Ukkola, P. H. Erkkilä, M. J. Savolainen, and Y. A. Kesäniemi, “Lack of association between polymorphisms of catalase, copper-zinc superoxide dismutase (SOD), extracellular SOD and endothelial nitric oxide synthase genes and macroangiopathy in patients with type 2 diabetes mellitus,” Journal of Internal Medicine, vol. 249, no. 5, pp. 451–459, 2001.
View at: Publisher Site | Google Scholar
N. M. Panduru, E. Moţa, M. Moţa, D. Cimponeriu, C. Serafinceanu, and D. M. Cheţa, “Polymorphism of catalase gene promoter in Romanian patients with diabetic kidney disease and type 1 diabetes,” Romanian Journal of Internal Medicine, vol. 48, no. 1, pp. 81–88, 2010.
View at: Google Scholar
R. P. Young, R. Hopkins, P. N. Black et al., “Functional variants of antioxidant genes in smokers with COPD and in those with normal lung function,” Thorax, vol. 61, no. 5, pp. 394–399, 2006.
View at: Publisher Site | Google Scholar
V. M. Iranpur and A. K. Esmailizadeh, Rapid Extraction of High Quality DNA from Whole Blood Stored at 4°C for Long Period, Department of Animal Science, Faculty of Agriculture, Shahrekord University, Shahrekord, Iran, 2010.
V. L. Kinnula, S. Lehtonen, P. Koistinen et al., “Two functional variants of the superoxide dismutase genes in Finnish families with asthma,” Thorax, vol. 59, no. 2, pp. 116–119, 2004.
View at: Publisher Site | Google Scholar
F. Sanger and A. R. Coulson, “A rapid method for determining sequences in DNA by primed synthesis with DNA polymerase,” Journal of Molecular Biology, vol. 94, no. 3, pp. 441–448, 1975.
View at: Publisher Site | Google Scholar
E. C. Chang, B. F. Crawford, Z. Hong, T. Bilinski, and D. J. Kosman, “Genetic and biochemical characterization of Cu,Zn superoxide dismutase mutants in Saccharomyces cerevisiae,” Journal of Biological Chemistry, vol. 266, no. 7, pp. 4417–4424, 1991.
View at: Google Scholar
F. M. F. Alameddine and A. M. Zafari, “Genetic polymorphisms and oxidative stress in heart failure,” Congestive Heart Failure, vol. 8, no. 3, pp. 157–172, 2002.
View at: Publisher Site | Google Scholar
L. W. Oberley and G. R. Buettner, “Role of superoxide dismutase in cancer: a review,” Cancer Research, vol. 39, no. 4, pp. 1141–1149, 1979.
View at: Google Scholar
R. De la Torre, A. Casado, E. López-Fernández, D. Carrascosa, V. Ramírez, and J. Sáez, “Overexpression of copper-zinc superoxide dismutase in trisomy 21,” Experientia, vol. 52, no. 9, pp. 871–873, 1996.
View at: Publisher Site | Google Scholar
D. R. Rosen, T. Siddique, D. Patterson et al., “Mutations in Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis,” Nature, vol. 362, no. 6415, pp. 59–62, 1993.
View at: Publisher Site | Google Scholar
I. N. Zelko, T. J. Mariani, and R. J. Folz, “Superoxide dismutase multigene family: a comparison of the CuZn-SOD (SOD1), Mn-SOD (SOD2), and EC-SOD (SOD3) gene structures, evolution, and expression,” Free Radical Biology and Medicine, vol. 33, no. 3, pp. 337–349, 2002.
View at: Publisher Site | Google Scholar
M. H. Ghattas and D. M. Abo-Elmatty, “Association of polymorphic markers of the catalase and superoxide dismutase genes with type 2 diabetes mellitus,” DNA and Cell Biology, vol. 31, no. 11, pp. 1598–1603, 2012.
View at: Publisher Site | Google Scholar
M. E. Rahbani-Nobar, A. Rahimi-Pour, M. Rahbani-Nobar, F. Adi-Beig, and S. M. Mirhashemi, “Total antioxidant capacity, superoxide dismutase and glutathion peroxidase in diabetic patients,” Medical Journal of Islamic Academy of Sciences, vol. 12, no. 4, pp. 109–114, 1999.
View at: Google Scholar
A. A. Sayed, Y. Aldebasi, S. O. Abd-Allah, S. M. El Gendy, A. S. Mohamed, and M. S. Abd El-Fattah, “Molecular and biochemical study of superoxide dismutase gene polymorphisms in egyptian patients with type 2 diabetes mellitus with and without retinopathy,” British Journal of Medicine and Medical Research, vol. 3, no. 4, pp. 1258–1270, 2013.
View at: Google Scholar
H. Fujita, H. Fujishima, S. Chida et al., “Reduction of renal superoxide dismutase in progressive diabetic nephropathy,” Journal of the American Society of Nephrology, vol. 20, no. 6, pp. 1303–1313, 2009.
View at: Publisher Site | Google Scholar
K. Yamashita, K. Takahiro, F. Kamezaki, T. Adachi, and H. Tasaki, “Decreased plasma extracellular superoxide dismutase level in patients with vasospastic angina,” Atherosclerosis, vol. 191, no. 1, pp. 147–152, 2007.
View at: Publisher Site | Google Scholar
M. Liao, Z. Liu, J. Bao et al., “A proteomic study of the aortic media in human thoracic aortic dissection: implication for oxidative stress,” Journal of Thoracic and Cardiovascular Surgery, vol. 136, no. 1, pp. 65–72, 2008.
View at: Publisher Site | Google Scholar

Copyright

Copyright © 2016 K. Nithya et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

PDF Download Citation

Download other formats

Order printed copies

Views

2132

Downloads

1118

Citations