Gastroenterology Research and Practice / 2013 / Article / Tab 1

Research Article

Lung and Intestine: A Specific Link in an Ulcerative Colitis Rat Model

Table 1

The sequences of the RT-PCR primers and cycling parameters.

Gene nameSequence of primers (5′-3′)Product size (bp)Cycling parameters

iNOSF: CCTCCTCCACCCTACCAAGT19910 min at 95°C; 40 cycles of 30 s at 95°C; 30 s at 60°C; 20 s at 72°C
R: CACCCAAAGTGCTTCAGTCA

GAPDHF: CCATGGAGAAGGCTGGG19510 min at 95°C; 40 cycles of 30 s at 95°C; 30 s at 54°C; 20 s at 72°C
R: CAAAGTTGTCATGGATGACC