Table 1: The primers used in the experiments.

NumberName Sequence (5′→3′)

Hs-HBsAgFTGGTTATCGCTGGATGTGTCTG
RCCGTGCTGGTGGTTGAGG

Hs-HBcAgFTGTGGTTATCCTGCGTTAATG
RGCGTCAGCAAACACTTGG

Hs-TLR3FTCCCAGCCTTACAGAGAAGC
RCCTGTGAGTTCTTGCCCAAT

Hs-GAPDHFGAAGGTGAAGGTCGGAGTC
RGAAGATGGTGATGGGATTC