Table 2: Primer sequences for qRT-PCR.

miR-143-FPACACTCCAGCTGGGTGAGATGAAGCACTG
miR-143-RPCTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGAGCTACA
miR-145-FPACACTCCAGCTGGGGTCCAGTTTTCCCAGGA
miR-145-RPCTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAGGGATTC
miR-192-FPACACTCCAGCTGGGCTGACCTATGAATTG
miR-192-RPCTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGGCTGTCA
miR-194-FPACACTCCAGCTGGGTGTAACAGCAACTCCA
miR-194-RPCTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTCCACATG
miR-203-FPACACTCCAGCTGGGGTGAAATGTTTAGGAC
miR-203-RPCTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCTAGTGGT
miR-205-FPACACTCCAGCTGGGTCCTTCATTCCACCGG
miR-205-RPCTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCAGACTCC
URPTGGTGTCGTGGAGTCG
U6-FPCTCGCTTCGGCAGCACA
U6-RPAACGCTTCACGAATTTGCGT