Gastroenterology Research and Practice / 2017 / Article / Tab 1

Research Article

The Methylation Status and Expression of Epstein-Barr Virus Early Genes BARF1 and BHRF1 in Epstein-Barr Virus-Associated Gastric Carcinomas

Table 1

Sequences of primers for MSP, BSP, and real-time PCR in this study.

PrimersSequence (5′-3′)Annealing temp (°C)Product size (bp)

MSPBARF1p-MFGTTGGATTTAGTTATTTTGTCGTTC73°C142
BARF1p-MRTTATCATATAAACCTAAAACCCGTA
BARF1p-UFGTTGGATTTAGTTATTTTGTTGTTTG70°C142
BARF1p-URTTATCATATAAACCTAAAACCCATA
BHRF1p-MFTTTGTATATTTGGTTAGTTGATCGA68°C218
BHRF1p-MRCGAAACGTAATACTTCCTAAAAACG
BHRF1p-UFTTTGTATATTTGGTTAGTTGATTGA66°C220
BHRF1p-URCCCAAAACATAATACTTCCTAAAAACA
BSPBARF1pBSP-FGTTAGTTAGGTTGGTTAGGGTTTA74°C738
BARF1pBSP-RCTCCAATAAAAAATCAAAATAACTC
BHRF1pBSP-FAGAATTTAGAGGAAGGGAATTTTATAGT73°C714
BHRF1pBSP-RACAACCAAAACAAAAATAAAAAAAA
qRT-PCRBARF1-FAGCCTCTCTGTTGCTGTTGA59°C130
BARF1-RAGTGCGTTTATTGCGACAAG
BHRF1-FGTACCCTGCATCCTGTGTTG59°C72
BHRF1-RCTACAGTGTCCTCTGGCGAA
GAPDH-FCTCAGACACCATGGGGAAGGTGA58°C450
GAPDH-RATGATCTTGAGGCTGTTGTCATA