Molecular Detection of Cucumber Mosaic Virus and Tobacco Mosaic Virus Infecting African Nightshades (Solanum scabrum Miller)

Table 1

Nucleotide sequences of oligonucleotide primers used for molecular testing, genomic locations, and target viruses in African nightshades.

Primers	Sequence (5′−3′)	Product size	Target strain
CV (F)	GCCACCAAAAATAGACCG	593 bp	Cucumber mosaic virus (CMV)
CV (R)	ATCTGCTGGCGTGGATTTCT
TMV (F)	CGATGATGATTCGGAGGC	512 bp	Tobacco mosaic virus (TMV)
TMV (R)	GAGGTCCARACCAAMCCAG

Note. The full-length primer sequences for the specific virus were sourced from the NCBI nucleotide database and manually aligned in a text editor. The primer design software Prifi [18] was used to select primers. CMV: cucumber mosaic virus; TMV: tobacco mosaic virus; F: forward primer; R: reverse primer; µl: microliters.