Table 1: Primer sequences used to obtain the point mutations and the sequence insertion on the TrkB FL receptor. The mutated bases are represented in bold.

PrimersSequence 5′ to 3′

TrkB.Y490F.F GTCATTGAAAACCCCCAGTTCTTCGGTATCACCAACAG
TrkB.Y490F.R CTGTTGGTGATACCGAAGAACTGGGGGTTTTCAATGAC
TrkB.Y816F.F GCGTCGCCCGTCTTCCTGGACATCCTAG
TrkB.Y816F.R CGCAGCGGGCAGAAGGACCTGTAGGATC
TrkB.Shc.F CTCAAGCCGGACACATGGCCCAGAGGTTCCCCCAAGACCGCCTGATAGTAATTTGTTCAGCACATC
TrkB.Shc.R GATGTGCTGAACAAATTACTATCAGGCGGTCTTGGGGGAACCTCTGGGCCATGTGTCCGGCTTGAG
TrkB K560M.F GGTGGCCGTGATGACGCTGAAGG
TrkB K560M.R CCTTCAGCGTCATCACGGCCACC
TrkB.SHC GTCATTGAAAACCCCCAGTTCTTCGGTATCACCAACAG
TrkB.SHC CTGTTGGTGATACCGAAGAACTGGGGGTTTTCAATGAC