International Journal of Endocrinology / 2013 / Article / Tab 1

Research Article

Estrogen Inhibits Colon Polyp Formation by Reducing Angiogenesis in a Carcinogen-Induced Rat Model

Table 1

Primer sequences of HIF-1α, VEGF-A, and GAPDH genes.

GeneForward sequenceReverse sequence

HIF-1αCCTACTATGTCGCTTTCTTGGGTTTCTGCTGCCTTGTATGGG
VEGF-ACAGCTATTGCCGTCCAATGACCAGGGCTTCATCATTGCA
GAPDHACAGCAACAGGGTGGTGGACTTTGAGGGTGCAGCGAACTT

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.