International Journal of Endocrinology / 2013 / Article / Tab 1

Research Article

Estrogen Inhibits Colon Polyp Formation by Reducing Angiogenesis in a Carcinogen-Induced Rat Model

Table 1

Primer sequences of HIF-1α, VEGF-A, and GAPDH genes.

GeneForward sequenceReverse sequence

HIF-1αCCTACTATGTCGCTTTCTTGGGTTTCTGCTGCCTTGTATGGG
VEGF-ACAGCTATTGCCGTCCAATGACCAGGGCTTCATCATTGCA
GAPDHACAGCAACAGGGTGGTGGACTTTGAGGGTGCAGCGAACTT

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.