Table 4: Sequences of CNR1 primers.

PolymorphismForward primer (3′-5′)Reverse primer (3′-5′)

A3813G (rs12720071)GATGAAGGCTCAGGGTGCTAGAGGTAGTGCTGTCAGCCCCATTGTCCC
G1422A (rs1049353)CCTGCGACACGCTTTCCGGACTGCCAGGGAGGCATCAGGC
A4895G (rs806368)GAGACCACCCATATCATGCACACAAACTCTGATCCCCAGTAGGCCTAG
rs806381CATGAGCCATGAGGTTTTCTCATTTGAAGGCCTGTAACTT
rs10485170TTAACCAATG GTTCATCGTCATGTGGTTCTCAGGCATCAG
rs6454674ATGGAGCCTGTCCTTTAGGTTATCCAGGAATGCTGCAAAA