International Journal of Endocrinology / 2014 / Article / Tab 1

Research Article

Negative Influence of a Long-Term High-Fat Diet on Murine Bone Architecture

Table 1

Primers used for RT-PCR.

TargetsSequenceLength (bp)Annealing (°C)Accession

-actin
 fwd1TGTTACCAACTGGGACGACA16558NM_007393.3
 rev2GGGGTGTTGAAGGTCTCAAA
Bglap3
 fwdTTCTGCTCACTCTGCTGACC11158NM_007541.2
 revTATTGCCCTCCTGCTTGGAC
ctsK4
 fwdGAGGCGGCTATATGACCACT11958NM_007802.3
 revCTTTGCCGTGGCGTTATACA
col15
 fwdTGGCATCCCTGGACAGCCTG14462NM_007742.3
 revATGGGGCCAGGCACGGAAAC

Forward; 2reverse; 3bglap: gene name of osteocalcin; 4cathepsin K; 5collagen 1 1.

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.