International Journal of Endocrinology / 2017 / Article / Tab 1

Research Article

Regulation of Corticosteroidogenic Genes by MicroRNAs

Table 1

Sequences of primers used in qRT-PCR assays.

GeneForward primerReverse primer

β-ActinCCAACCGCGAGAAGATGACCAGAGGCGTACAGGGATAG
GAPDHGCTCTCTGCTCCTCCTGTTCACGACCAAATCCGTTGACTC
StARTACGTGGCTACTCAGCATCGACCTGGTTGATGATGCTCTTG
CYP11A1AGGAGGGGTGGACACGACTTGCGTGCCATCTCATACA
CYP21A1GAGGGCACAGTCATCATTCCGCTCCAGGAAGCGATCAG
CYP17A1CTATGCTCATCCCCCACAGTTGTCCACAGCAAACTCACC
HSD3B2AGGCCTTCAGACCAGAATTGCCTCAAGTACAGTCAGCTTGG
CYP11B1ACTAGGGCCCATTTTCAGGTGGCAGCATCACACACACC
CYP11B2GCACCTGCACCTGGAGATGCACACACCATGCGTGGTCC
HSD11B2GGGTCAAGGTCAGCATCATCCACTGACCCACGTTTCTCAC