Mutational Spectrum Analysis of Seven Genes Associated with Thyroid Dyshormonogenesis

Table 2

Potential pathological variants detected in this study.

Gene	Amino acid change	Nucleotide change	Genomic position	Exon/intron position	rs ID	Status	Frequency of variant allele		Reference
							Han Chinese patients ()	Normal control ()
DUOX2	p.P76L	c.227C>T	chr15:45404850	Exon 4	rs767705906	Known	0.024	0
DUOX2	p.R432H	c.1295G>A	chr15:45401090	Exon 12	rs530736554	Known	0.02	0
DUOX2	p.R434_S440 del	c.1300_1320delCGAGATATGGGGCTGCCCAGC	chr15:45401064	Exon 12	NA	Novel	0.024	0
DUOX2	p.D435G	c.1304A>G	chr15:45401081	Exon 12	rs772040742	Known	0.024	0
DUOX2	p.K530X	c.1588T>A	chr15:45399648	Exon 14	rs180671269	Known, DM	0.095	0	[20]
DUOX2	p.R683L	c.2048G>T	chr15:45398423	Exon 17	rs8028305	Known, DM?	0.024	0	[39]
DUOX2	IVS17+1G>T	c.2148+1G>T	chr15:45398322	Intron 17	NA	Novel	0.024	0
DUOX2	p.H678R	c.2033A>G	chr15:45398438	Exon 17	rs57659670	Known, DFP	0.19	0.092	[20]
DUOX2	p.V779M	c.2335G>A	chr15:45396563	Exon 19	rs145061993	Known, DM?	0.024	0.005	[11]
DUOX2	p.R885Q	c.2654G>A	chr15:45396158	Exon 20	rs181461079	Known, DM	0.071	0.005	[20]
DUOX2	p.S906P	c.2716T>C	chr15:45394126	Exon 21	rs768362375	Known	0.024	0
DUOX2	p.M927V	c.2779A>G	chr15:45394063	Exon 21	rs755186335	Known	0.048	0
DUOX2	p.S1067L	c.3200C>T	chr15:45392075	Exon 25	rs269868	Known, DM?	0.286	0.085	[20]
DUOX2	p.R1110Q	c.3329G>A	chr15:45391946	Exon 25	rs368488511	Known, DM	0.143	0.005	[48]
DUOX2	p.L1160del	c.3478_3480delCTG	chr15:45391615	Exon 26	rs758318135	Known, DM	0.024	0	[11]
DUOX2	p.R1211H	c.3632G>A	chr15:45389873	Exon 28	rs141763307	Known, DM	0.024	0.005	[49]
DUOX2	IVS28+1G>T	c.3693+1G>T	chr15:45389811	Intron 28	rs200717240	Known	0.048	0
DUOX2	p.A1323T	c.3967G>A	chr15:45388139	Exon 30	rs550037603	Known, DM	0.024	0	[6]
DUOX2	p.L1343F	c.4027C>T	chr15:45388079	Exon 30	rs147945181	Known, DM?	0.048	0	[6]
DUOX2	p.G1513R	c.4537G>C	chr15:45386458	Exon 34	rs748262140	Known	0.048	0
DUOX2	p.G1521X	c.4561G>T	chr15:45386434	Exon 34	rs765781255	Known^a	0.024	0
DUOXA2	p.R133H	c.398G>A	chr15:45408771	Exon 4	NA	Novel	0.024	0
DUOXA2	p.Y138X	c.413dupA	chr15:45408785	Exon 4	rs778410503	Known, DM	0.048	0	[43]
DUOXA2	p.Y246X	c.738C>G	chr15:45409472	Exon 5	rs4774518	Known, DM	0.048	0	[7]
SLC26A4	p.A429E	c.1286C>A	chr7:107334870	Exon 11	rs753269996	Known, DM	0.024	0	[50]
TG	p.G505D	c.1514G>A	chr8:133899131	Exon 9	NA	Novel	0.024	0
TG	p.C687LfsX34	c.2060_2060delG	chr8:133899676	Exon 9	NA	Novel	0.024	0
TG	IVS10-1G>A	c.2762-1G>A	chr8:133905934	Intron 10	NA	Known, DM	0.024	0	[51]
TG	p.S1139L	c.3416C>T	chr8:133912567	Exon 15	rs201480815	Known	0.024	0	[22]
TG	p.G1456R	c.4366G>A	chr8:133925498	Exon 20	rs769800036	Known	0.024	0

Polymorphic variant; status evaluated based on whether variants are reported in public databases or published literature. Variants were reported in public population databases, such as dbSNP, ExAC, or 1000 Genomes Project but without phenotypic data and pathological assessment; variants were reported in the published literature as well as HGMD (professional version 2016.03); DM: disease-causing mutation; DM?: a possible disease-causing mutation; DFP: disease-associated polymorphism with supporting functional evidence; variants were reported in the published literature; NA: data not available; MAF: minor allele frequency. ; according to Fisher’s exact test, which compared allelic frequencies of detected variants in patients versus local controls.