International Journal of Endocrinology / 2019 / Article / Tab 1

Research Article

miR-129-5p Inhibits Adipogenesis through Autophagy and May Be a Potential Biomarker for Obesity

Table 1

Primer sequences employed in this study.

Gene nameForward primer sequence (5′–3′)Reverse primer sequence (5′–3′)

C/EBPαCAAGAACAGCAACGAGTACCGGTCACTGGTCAACTCCAGCAC
PPARγTCGCTGATGCACTGCCTATGGAGAGGTCCACAGAGCTGATT
UCP1AGGCTTCCAGTACCATTAGGTCTGAGTGAGGCAAAGCTGATTT
CIDEATGCTCTTCTGTATCGCCCAGTGCCGTGTTAAGGAATCTGCTG
PRDM16CCACCAGCGACTTCACGCAGGACTCTCGTAGCTCGAA
FABP4AGCATCATAACCCTAGATGGCGCATAACACATTCCACCACCAGC
ATG7GTTCGCCCCCTTTAATAGTGCTGAACTCCAACGTCAAGCGG
SOX2GCGGAGTGGAAACTTTTGTCCCGGGAAGCGTGTACTTATCCTT
HMGB1GGCGAGCATCCTGGCTTATCGGCTGCTTGTCATCTGCTG
TMEM65CCATCGCACAAGGTAAGCGGACAGGGGTCTGAGAAGTAGG
INSIG1CACGACCACGTCTGGAACTATTGAGAAGAGCACTAGGCTCCG
β-ACTINGCCAGCCTCTCCTGATTTTAGTGTGGGAACACAAAAGACCTCTTCTGG