International Journal of Evolutionary Biology / 2012 / Article / Tab 2

Research Article

DNA Barcoding and Molecular Phylogeny of Drosophila lini and Its Sibling Species

Table 2

Target regions and primer sequences in the present study.

Target regionPrimer sequence ( )Length (bp)

Mitochondrial loci
ND2 AAGCTACTGGGTTCATACC926
ATATTTACAGCTTTGAAGG
 COI-COIIATACCTCGACG(AT)TATTGA842
GTTTAAGAAACCAGTACTTG

Nuclear locus
ITS1-ITS2 TCCGTAGGTGAACCTGCGG650
GTTAGTTTCTTTTCCTC

Total2418

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.