Table 2: Target regions and primer sequences in the present study.

Target regionPrimer sequence ( )Length (bp)

Mitochondrial loci
ND2 AAGCTACTGGGTTCATACC926
ATATTTACAGCTTTGAAGG
 COI-COIIATACCTCGACG(AT)TATTGA842
GTTTAAGAAACCAGTACTTG

Nuclear locus
ITS1-ITS2 TCCGTAGGTGAACCTGCGG650
GTTAGTTTCTTTTCCTC

Total2418