Table 2: Primers and thermal profiles used for the qPCR and DGGE.

Target geneprimersThermal profile

qPCRnosZ-F [29]  
nosZ1622R [29]
qPCR: 94°C/2 min; 6 cycles of 94°C/30 s, 57°C/30 s (−1°C/cycle), and 72°C/45 s; 30 cycles of 94°C/30 s, 52°C/30 s, and 72°C/45 s.
DGGEnosZ-F [29]  
nosZ1622-GC [30]
DGGE: 94°C/2 min; 10 cycles of 94°C/30 s, 58°C/30 s (−0.5°C/cycle), and 72°C/60 s; 30 cycles of 94°C/30 s, 53°C/30 s, and 72°C/60 s; 72°C/10 min.

qPCRCd3aF [31]  
R3cd [31]
q-PCR: 94°C/2 min; 6 cycles of 94°C/30 s, 57°C/30 s (−1°C/cycle), and 72°C/45 s; 30 cycles of 94°C/30 s, 52°C/30 s, and 72°C/45 s.
DGGECd3aF [31]  
R3cd-GC [32]
DGGE: 94°C/2 min; 10 cycles of 94°C/30 s, 57°C/30 s (−0.5°C/cycle), and 72°C/45 s; 30 cycles of 94°C/30 s, 52°C/30 s, and 72°C/45 s; 72°C/10 min.

qPCRF1aCu [33]  
R3Cu [33]
q-PCR: 95°C/3 min; 6 cycles of 95°C/30 s, 63°C/30 s (−1°C/cycle), and 72°C/30 s; 32 cycles of 95°C/30 s, 58°C/30 s, and 72°C/30 s.
DGGEF1aCu [33]  
R3Cu-GC [33]
DGGE: 95°C/3 min; 32 cycles of 95°C/30 s, 58°C/30 s, and 72°C/45 s; 72°C/10 m.

(GGCGGCGCGCCGCCCGCCCCGCCCCCGTCGCCC) was attached to the 5′ end of the primers.