The Association between Gly460Trp-Polymorphism of Alpha-Adducin 1 Gene (ADD1) and Arterial Hypertension Development in Ukrainian Population

Table 2

Primer nucleotide sequence and PCR conditions.

Primer nucleotide sequence	PCR conditions (n = 40 cycles)			PCR amplicon size	Restriction fragments
	D	H	E
Fwd: 5`GACCCTAGGGCTACAGAACTG3`	94°C (30 s)	63°C (30 s)	72°C (30 s)	252	GG 225; 27
					GT 252; 225; 27
Rev: 5`TCGACTTGGGACTGCTTCCATTCGGCC3`
					TT 252

D: denaturation; H: hybridization; E: elongation; Fwd: forward primer; Rev: reverse primer.