|
Primer | Sequence | Gene | Reference | Amplification conditions | Amplicon size (bp) |
|
aac(3′)-II | F: ATATCGCGATGCATACGCGG R: GACGGCCTCTAACCGGAAGG | aac(3′)-II | [20] | Initial denaturation at 95°C for 15 min, then 30 cycles of 95°C for 1 min, 55°C for 1 min, and 72°C for 5 minutes, and one cycle of final elongation at 72°C. | 877 |
|
aac(6′)-Ib | F: TTGCGATGCTCTATGAGTGGCTA R: CTCGAATGCCTGGCGTGTTT | aac(6′)-Ib | [20] | Initial denaturation at 95°C for 15 min, then 30 cycles of 95°C for 1 min, 55°C for 1 min, and 72°C for 5 minutes, and one cycle of final elongation at 72°C. | 472 |
aac(6′)-II | F: CGACCATTTCATGTCC R: GAAGGCTTGTCGTGTTT | aac(6′)-II | [20] | 542 |
|
ant(3′′)-I | F: CATCATGAGGGAAGCGGTG R: GACTACCTTGGTGATCTCG | ant(3′′)-I | [20] | Initial denaturation at 95°C for 15 min, then 30 cycles of 95°C for 1 min, 55°C for 1 min, and 72°C for 5 minutes, and one cycle of final elongation at 72°C. | 787 |
|
aph(3′)-VI | F: ATGGAATTGCCCAATATTATT R: TCAATTCAATTCATCAAGTTT | aph(3′)-VI | [20] | Initial denaturation at 95°C for 15 min, then 30 cycles of 95°C for 1 min, 55°C for 1 min, and 72°C for 5 minutes, and one cycle of final elongation at 72°C. | 780 |
armA | F: CCGAAATGACAGTTCCTATC R: GAAAATGAGTGCCTTGGAGG | armA | [20] | 846 |
|
rmtB | F: ATGAACATCAACGATGCCCTC R: CCTTCTGATTGGCTTATCCA | rmtB | [20] | Initial denaturation at 95°C for 15 min, then 30 cycles of 95°C for 1 min, 60°C for 1 min, and 72°C for 5 minutes, and one cycle of final elongation at 72°C. | 769 |
|
phoE | F: TGGCCCGCGCCCAGGGTTCGAAA R: GATGTCGTCATCGTTGATGCCGAG | phoE | [21] | Initial denaturation at 95°C for 15 min, then 35 cycles of 95°C for 1 min, 40°C for 1 min, and 72°C for 5 minutes, and one cycle of final elongation at 72°C. | 368 |
ERIC-1R | R: AACCCACGATGTGGGTAGC | — | [22] | — |
|