Table of Contents Author Guidelines Submit a Manuscript
International Journal of Microbiology
Volume 2018, Article ID 4568520, 10 pages
https://doi.org/10.1155/2018/4568520
Research Article

Morphological and Molecular Identification of the Causal Agent of Anthracnose Disease of Avocado in Kenya

1Department of Plant Sciences, Kenyatta University, P.O. Box 43844, Nairobi, Kenya
2Department of Microbiology, Kenyatta University, P.O. Box 43844, Nairobi, Kenya
3Kenya Agricultural and Livestock Research Organisation, P.O. Box 220, Thika, Kenya
4Jomo Kenyatta University of Agriculture and Technology, P.O. Box 62000, Nairobi, Kenya

Correspondence should be addressed to S. K. Kimaru; moc.liamg@1uramiks

Received 1 November 2017; Revised 25 January 2018; Accepted 31 January 2018; Published 27 February 2018

Academic Editor: Pierre Roques

Copyright © 2018 S. K. Kimaru et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Anthracnose disease of avocado contributes to a huge loss of avocado fruits due to postharvest rot in Kenya. The causal agent of this disease has not been clear but presumed to be Colletotrichum gloeosporioides as reported in other regions where avocado is grown. The fungus mainly infects fruits causing symptoms such as small blackish spots, “pepper spots,” and black spots with raised margin which coalesce as infection progresses. Due to economic losses associated with the disease and emerging information of other species of fungi as causal agents of the disease, this study was aimed at identifying causal agent(s) of the disease. A total of 80 fungal isolates were collected from diseased avocado fruits in Murang’a County, the main avocado growing region in Kenya. Forty-six isolates were morphologically identified as Colletotrichum spp. based on their cultural characteristics, mainly whitish, greyish, and creamish colour and cottony/velvety mycelia on the top side of the culture and greyish cream with concentric zonation on the reverse side. Their spores were straight with rounded end and nonseptate. Thirty-four isolates were identified as Pestalotiopsis spp. based on their cultural characteristics: whitish grey mycelium with black fruiting structure on the upper side and greyish black one on the lower side and septate spores with 3-4 septa and 2 or 3 appendages at one end. Further molecular studies using ITS indicated Colletotrichum gloeosporioides, Colletotrichum boninense, and Pestalotiopsis microspora as the causal agents of anthracnose disease in avocado. However, with this being the first report, there is a need to conduct further studies to establish whether there is coinfection or any interaction thereof.

1. Introduction

The anthracnose disease is a common disease with wide host range causing severe economic loss. The disease has been reported on a wide variety of crops including avocado, almond, coffee, guava, apple, dragon fruit, cassava, mango, sorghum, and strawberry causing severe economic losses [14]. The causal agents of this disease are not clear. However, species of the genus Colletotrichum and Pestalotiopsis have been reported as causal agents of anthracnose in avocado [5, 6]. Such species includes C. gloeosporioides, C. acutatum, C. boninense, C. karstii, C. godetiae[711], and Pestalotiopsis versicolor [6].

Symptoms of anthracnose appear as pepper spot or speckle spot on immature fruit while still on tree and after fruit harvest during ripening as darkly, black coloured, sunken rounded spots with raised margins on fruit skins [12]. These lesions enlarge rapidly on the fruit skin and into the pulp leading to the death and rotting of the infected plant tissues [13]. The lesions may develop salmon-coloured, sticky spore masses typical of anthracnose diseases of this and many other plant species.

The avocado fruit has a high nutritional value since it contains vitamins (E, B, and C), minerals (potassium, iron, and phosphorus) and a great amount of oil [14]. In Kenya, avocado fruit is one of the most economically important fruits grown by both small and large scale farmers (HCDA, 2016). The fruit is mainly grown for fresh market but there is increasing demand from pharmaceutical, cosmetics, and vegetable oil industries (HCDA, 2016).

Anthracnose caused by Colletotrichum gloeosporioides has been associated with severe losses of avocado fruits both in the field and after harvest as compared to Pestalotiopsis spp. whose impact is not widely studied [5, 1518]. Wasilwa et al. [19] reported that over 60% of the Kenyan avocado production cannot be marketed because of damage and low quality of fruits associated with anthracnose disease. Despite the huge losses associated with the anthracnose disease of avocado in Kenya, no cultural and molecular studies have been done to identify the causal agent(s). During the investigation, this paper aimed to identify the causal agent(s) of anthracnose of avocado in Kenya.

2. Materials and Methods

2.1. Fungal Isolation and Culturing

Samples of infected avocado fruits showing symptoms of anthracnose were collected from study area, Murang’a County, and brought to the laboratory for fungal isolation. The typical symptoms were small blackish spots “pepper spot” to larger blackish spots with raised margin [5]. The samples were cleaned using tap water and blotted to remove excess water. The fruits were surface sterilized using 0.5% sodium hypochlorite for 30 seconds. Small sections of the diseased area were cut aseptically and placed on hardened potato dextrose agar (PDA) in Petri dishes for fungal growth at room temperature (22–25°C). The emerging fungi were subcultured to obtain pure cultures. To obtain pure cultures, single spore isolation was done as follows: cultures were flooded with sterile distilled water and conidia were scraped off the plate using sterilized wire loop and suspended in 1 ml of sterile distilled water. A loopful of conidial suspension was spread evenly on 1.5% (wt/vol) water agar in a Petri dish and incubated at 25°C overnight. Using a sterilized glass needle germinated conidium was transferred onto hardened PDA in 9 cm diameter Petri dish and incubated at 25°C with a 12 h cycle of fluorescent light to induce growth and sporulation. To avoid bacterial contamination 0.5 g/l of streptomycin was added to PDA at molten state of about 50°C [20]. Single spore pure cultures of the pathogen were preserved in the slant universal bottle and stored in the fridge at 4°C for later use.

The fungi, C. gloeosporioides and Pestalotiopsis spp., were morphologically identified based on cultural and microscopical characteristics using published fungal key [21, 22].

2.2. Inoculation, Mycelial Growth, and Sporulation of C. gloeosporioides Isolates

Pure cultures of C. gloeosporioides preserved in universal bottles were used. Using a sterilized surgical scalpel, sections of mycelial plugs were cut aseptically and placed on hardened PDA on 9 cm diameter Petri dishes and incubated for 10 days for mycelial growth.

Five-millimetre mycelia plugs from the 10-day-old pure isolates of C. gloeosporioides were aseptically cut using five-millimetre diameter cork borer and placed individually at the centre of hardened PDA culture in 9 cm diameter Petri dishes. The cultures were incubated at room temperatures of ranges 22–25°C. Mycelia diameters of the isolates were measured at days 2, 4, 6, 8, and 10 after inoculation. On eleventh day, the cultures were flooded with distilled water and scrapped to bring the spores into suspension. The suspension was filtered through double layer cheese cloth to remove mycelia. The spore suspension was serially diluted to 10−6 for ease of counting the spores. The spore concentration was determined by use of haemocytometer.

2.3. Conidial Morphology and Size

Using a pipette, a drop of spore suspension (10−6) was placed on a microscope slide, covered with a cover slip. The spores were stained with lactophenol cotton blue and observed under microscope. The shape of the spores from different isolates was noted and their sizes in terms of length and width were measured using a calibrated ocular slide and stage micrometer.

2.4. Determination of Genetic Diversity of Fungal Isolates
2.4.1. DNA Extraction

Pure fungal cultures in potato dextrose agar derived from a single spore from the original isolate were used. An improved fungal extraction protocol as described by Liu et al. [23] was used. About 40 mg of mycelia was placed in an Eppendorf tube containing 2 ml of extraction buffer (Tris-HCl, 100 mM; EDTA, 10 mM; NaCl, 1 M; SDS, 1%; proteinase K, 0.05 mg ml−1; pH 8.0) and 10% (v/v) glass beads and ground into powder. The samples were vortexed and incubated at 65°C for 30 minutes. After incubation, the samples were centrifuged at 10,000 ×g for 15 min and supernatant was transferred to a fresh tube. To the supernatant, 150 μl of 3 M guanidine hydrochloride was added and incubated at −20°C for 10 minutes. The samples were centrifuged at 10,000 ×g for 10 minutes. After centrifugation the supernatant was transferred to a fresh tube, and an equal volume of isopropanol was added. Samples were incubated at −20°C for 3 h. The samples were centrifuged for 10 min at 10,000 ×g and thereafter 70% ethanol was added and more centrifugation done for 10 min at 10,000 ×g. The nucleic acid pellet obtained was air dried and dissolved in 50 μl of TE buffer (Tris-HCl, 10 mM, pH 8; EDTA, 1 mM). The nucleic acid dissolved in TE buffer was further treated with 3 μl of RNase (10 mg ml−1), to precipitate RNA at 37°C, and the pure DNA obtained was stored at −20°C for later use. The quality of DNA was determined by loading 5 μl of DNA on 1% agarose before running it for 45 volts for 30 minutes and bands were noted by visualization under the UV gel imager.

2.4.2. Polymerase Chain Reactions and Gel Electrophoresis

The DNA extracted from isolates of the pathogens was used as template in polymerase chain reaction. Two sets of primers were used; the first set contained the universal primers ITS1 (5′-TCCGTAGGTGAACCTGCGG-3′) and ITS4 (5′-TCCTCCGCTTATTGATATGC-3′) targeting all fungal isolates while the other set was a primer CgInt (5′-GGGGAAGCCTCTCGCGG-3′) specific to Colletotrichum gloeosporioides combined with the universal primer ITS4 (TCCTCCGCTTATTGATATGC) for the identification of the isolates. The amplified regions were subsequently sequenced to obtain sufficient information for the identification of isolates.

2.4.3. Agarose Gel Electrophoresis

A 1.5% agarose gel was prepared using 1x TBE-buffer and stained with 5 μl of SYBR Safe and poured into casting tray having a comb to solidify. The first well of the solid gel was loaded with 1.5 μl 1 Kb marker, followed by 2 μl of each amplified product and a control at the end. The gel was connected to electric voltage of 100 volts for 45 minutes to allow migration of amplified PCR products. The DNA bands formed were visualized under UV light and images photographed using a camera connected to a computer.

2.4.4. DNA Cleaning and Sequencing

The amplified products of the target fragments obtained above were cleaned using the Qiagen PCR cleaning kit according to the manufacturer instructions. The cleaned fragments were submitted for Sanger sequencing at Inqaba Africa Genomic platform in South Africa together with the primers used for amplification (ITS1 and ITS4 and ITS4 and CgInt).

2.5. Bioinformatics Analysis

The sequences obtained from Inqaba Africa Genomic platform at South Africa were trimmed before subjecting them to alignment with other Genbank sequences. Gene alignment was done using BioEdit software version while phylogenetic analysis was done by Mega Molecular Evolutionary Genetic Analysis version 7.1.8.

Alignment of sequences of the isolates and phylogenetic analyses was done using Mega 7.18 [24]. The maximum likelihood trees were obtained using the Close-Neighbour-Interchange algorithm while missing data and gaps were eliminated [25]. Clade stability of the resultant phylogenetic tree was based on bootstrap analysis with 1000 replicates [26]. Evolutionary distances in form of number of base substitution per site were computed using the Maximum Composite Likelihood method [24].

3. Results

3.1. Fungal Isolates

A total of 80 fungal isolates from diseased avocado fruits showing symptoms of anthracnose (Figure 1) collected from the study area were obtained. The isolates were identified based on cultural morphological characteristic on PDA and spore characteristics as observed under microscope [27, 28].

Figure 1: Anthracnose symptoms on avocado fruit.

A total of 46 isolates had whitish, greyish, or creamish colour and cottony, velvety mycelium on the top side and greyish cream with circular orange-pinkish colour on the reverse side, Figure 2(a). Their spores were straight with rounded end (Figure 2(b)), typical of C. gloeosporioides [29]. The remaining 34 isolates had whitish grey mycelium with black fruiting structure on the upper side and greyish black one on the lower side (Figure 2(c)). Their spores had 3-4 septa and 2 or 3 appendages at one end characteristics of Pestalotiopsis microspora [30] (Figure 2(d)).

Figure 2: Mycelia of Colletotrichum gloeosporioides (a) and Colletotrichum gloeosporioides spores (b) (×400) and mycelia of Pestalotiopsis microspora (c) and Pestalotiopsis microspora spores (d) (×400).

The isolates were further confirmed through Koch’s postulate where ten-day-old pure cultures of the isolates growing on PDA were used to inoculate healthy ripe avocado fruit, Fuerte variety. After two days, a characteristic black spot was formed by both Colletotrichum and Pestalotiopsis isolates. Each of the reisolated fungi from the diseased fruit showed similar morphological, cultural, and spore characteristics as initial isolates.

The Colletotrichum isolates were subjected to more detailed study while the Pestalotiopsis spp. was identified further at molecular level using universal primers ITS1 and ITS4.

3.2. The Mycelial Growth of Colletotrichum Isolates

The Colletotrichum gloeosporioides isolates from the study area grew rapidly on the PDA medium covering the whole surface of the Petri dish in 10–12 days after inoculation. The mycelial colour of the isolates varied between whitish grey, whitish cream, and greyish pink on the upper side of the culture (Table 1). Similarly, the lower side of the cultures had creamish grey, greyish orange, and grey (Table 1). In terms of mycelia structure, cottony one was observed in 24 isolates as compared to velvety one observed in 22 isolates (Table 1). There was significant difference (, df = 2, and ) among the observed and expected frequencies for the cultural texture and colour of various Colletotrichum gloeosporioides isolates (Table 1).

Table 1: Cultural and morphological characteristics of the Colletotrichum  gloeosporioides on PDA.
3.3. Mycelial Growth of Colletotrichum gloeosporioides Isolates

The mycelial diameter of the isolates showed significant differences () throughout the growth period (Table 2). However, they exhibited similar trend in growth with day two having the least and day 10 having the largest diameter per isolate (Table 2). The radial diameter of all the isolates ranged from 0.3 to 0.93 cm and 2.37 to 4.5 cm in day 2 and day 10, respectively (Table 2).

Table 2: Daily mycelial growth and mean number of spores of Colletotrichum  gloeosporioides isolates.
3.4. Sporulation of the Colletotrichum Isolates

Sporulation of Colletotrichum gloeosporioides isolates exhibited a wide range of mean number of spores per isolate ranging from the lowest to the highest spores per ml (Table 2). These mean number of spores per ml differed significantly at among isolates. Isolate s1 had the highest mean number of per ml which was significantly different from the rest at (Table 2). A total of 24 isolates had mean number of spores lower than the tabulated mean of all the isolates of per isolate.

3.5. Conidial Morphology and Size

All the spores observed were cylindrical and straight with smooth round end. The spore size varied significantly at among isolates ranging from 3.0 to 5.0 μm in width and 10.3 to 18.2 μm in length (Table 3). The spore widths of isolates s1, s40, and s44 were highest at 5.0 μm and they differed significantly from the rest at (Table 3). Similarly, these isolates produced the longest spores of 18.2, 18.0, and 18.0 μm for isolate s1, s40, and s44, respectively. Isolates s37 and s46, however, produced the smallest spores having a mean of 3.0 μm in width and 10.3 μm in length. Thirty-one isolates produced spores having width within the range of 3.1–3.5 μm which did not differ significantly at (Table 3). Overall, spore size in terms of width and length differed significantly at among isolates.

Table 3: The mean width and length of spores in micron (μm) produced by 10-day-old Colletotrichum  gloeosporioides isolates.
3.6. Phylogenetic Studies of Colletotrichum gloeosporioides and Pestalotiopsis microspora

The molecular identification of C. gloeosporioides and Pestalotiopsis spp. was inferred from 13 sequences of C. gloeosporioides and 10 sequences of Pestalotiopsis isolates. A phylogenetic tree (Figure 1) was made of sequences from C. gloeosporioides, Pestalotiopsis microspora, and reference sequences from the Genbank (Figure 3). The identity of the isolates of both Colletotrichum and Pestalotiopsis to the Genbank isolates ranged from 98% to 100%.

Figure 3: Maximum likelihood tree showing the relationship of Colletotrichum gloeosporioides complex and Pestalotiopsis microspora isolates based on ITS region.

The phylogenetic analysis of the isolates and references from the Genbank resulted into three clades: Clade 1 (Colletotrichum gloeosporioides), Clade 2 (Colletotrichum boninense), and Clade 3 (Pestalotiopsis microspora) (Table 4 and Figure 3).

Table 4: Colletotrichum and Pestalotiopsis isolates with their Genbank accession number.

4. Discussion and Conclusion

4.1. Cultural and Morphological Characteristics of Colletotrichum gloeosporioides and Pestalotiopsis microspora Isolates

The fungal isolates from diseased avocado fruits showing symptoms of anthracnose collected from the study area varied significantly in their cultural characteristics on PDA media in terms of texture and colour. A total of 46 isolates had whitish, greyish, or creamish colour and cottony, velvety mycelium on the top side and greyish cream with circular orange-pinkish colour on the reverse side. Similar cultural characteristics among Colletotrichum gloeosporioides isolates from avocado fruits were observed by [31]. Further, Chowdappa et al. [32] also noted the wide cultural variations among C. gloeosporioides isolates. The mycelial growth, however, had uniform radial growth characterised by circular ring-like patterns common to C. gloeosporioides. Sharma and Kulshrestha [4] reported similar mycelial growth characteristic of C. gloeosporioides in vitro. The cultures produced spores which were straight with rounded end, ranging within 3.0–5.0 μm in width and 10.3–18.2 μm in length, characteristic of Colletotrichum gloeosporioides as also reported by Chowdappa et al. [32].

The remaining 34 isolates had whitish cream mycelium with black fruiting structure, acervuli on the upper side, and had light orange to orange at lower side. These isolates produced spores having 3-4 septa and 2 or 3 appendages, characteristics of Pestalotiopsis microspora as reported by El-argawy [33]. Further molecular characteristic of these isolates using universal primers ITS1 and ITS4 confirmed the species as Pestalotiopsis microspora as discussed below in molecular characterisation section.

The differences observed in cultural and morphological characters of the isolates could be associated with their genetic variations and repeated subculturing [34, 35]. Further, the isolates had significantly different growth rate at (Table 2). Such growth rate among C. gloeosporioides isolates was also reported by Zakaria and Bailey [31]. Overall the proportion in percentage (%) of the variance in mycelia radial diameter that was predictable from days for the isolates varied from the lowest () to highest value ().

In this study, sporulation by Colletotrichum gloeosporioides isolates exhibited a wide range of mean number of spores per isolate from lowest to the highest spores per ml (Table 3) similar to observation made by Peres et al. [9]. These mean numbers of spores per ml differed significantly at among isolates (Table 3).

The spores observed in this study were cylindrical and straight with smooth round end. Similar spores of C. gloeosporioides were observed by Chowdappa et al. [32]. The spore size varied significantly at among isolates ranging within 3.0–5.0 μm in width and 10.3–18.2 μm in length (Table 3). Overall, spore size in terms of width and length differed significantly at among isolates.

4.2. Phylogenetic Studies of Colletotrichum gloeosporioides and Pestalotiopsis microspora

Phylogenetic results showed that ribosomal internal transcribed spacers (ITS) DNA can be used to indicate the relationships within Colletotrichum and Pestalotiopsis species. The study identified Colletotrichum gloeosporioides and Colletotrichum boninense based on a randomly selected sample of 13 sequences of Colletotrichum gloeosporioides isolates using ITS4 (universal) and CgInt (C. gloeosporioides specific) primers yielding single band of 450 bp and 98–100% homology with nucleotide sequence of ITS region of DNA with C. gloeosporioides isolates in the Genbank (Figure 1). This was in agreement with the nucleotide sequence of ITS region of ribosomal DNA of Colletotrichum gloeosporioides isolates from orchids amplified using specific primers CgInt and ITS4 as reported by Chowdappa et al. [32]. Further, molecular identification of Pestalotiopsis microspora was based on 10 randomly selected sequences of Pestalotiopsis microspora isolates using universal ITS1 and ITS4 primers for DNA sequencing.

Twelve isolates of C. gloeosporioides, one isolate of C. boninense, and ten isolates of P. microspora from the study area gave identical sequences of the published sequences in the Genbank for the same species with 94%, 98%, and 100% bootstraps value, respectively (Figure 1). Colletotrichum gloeosporioides identified in this study has been reported as the most common and wide spread pathogen in all avocado growing region worldwide [3638]. Further it has been associated with infection of other hosts such as almond, coffee, guava, apple, dragon fruit, cassava, mango, sorghum, and strawberry [2, 15, 39]. Though C. boninense identified is not very common in the study area, its sequence was identical to published sequence (KX 343044.1 and KU356916.1) in the Genbank. This species, among others like Colletotrichum acutatum, Colletotrichum godetiae, C. fioriniae, C. aenigma, and Colletotrichum gigasporum, has been reported to cause anthracnose of avocado [11, 16, 40, 41].

The ten randomly sampled isolates of P. microspora identified in this study showed 100% identity with the published sequences in the Genbank thereby confirming their identity (Figure 1). Pestalotiopsis species are widespread in both tropical and temperate region [42, 43]. Individual species of Pestalotiopsis are known to cause infection on a wide range of hosts [44, 45]. Pestalotiopsis clavispora is known to cause stem end rot of avocado [6]; P. versicolor has been reported as a causal agent of anthracnose in avocado [46]. P. palmarum known to cause leaf spot and fruit canker in avocado [47]. Though P. microspora is prevalent in both tropics and subtropics, its association with host plants is not well researched [48]. It has been regarded both as an endophyte and as a pathogen causing postharvest diseases [49]. It has been reported to cause scab disease of guava fruits in Hawaii [48]. In this study, the fungus was isolated from diseased avocado fruits showing symptoms associated with anthracnose disease of avocado. However, despite its prevalence, P. microspora and its role in plant ecology are poorly understood [49].

Conclusively, Colletotrichum gloeosporioides, Colletotrichum boninense, and Pestalotiopsis microspora were identified for the first time as the causal agents of anthracnose of avocado in Kenya through cultural, morphological, and molecular techniques.

Conflicts of Interest

The authors declare that there are no conflicts of interest regarding the publication of this article.

Authors’ Contributions

S. K. Kimaru conceived, designed, and performed experiments and was responsible for collection of diseased avocado fruits and isolation of fungi, morphological identification of the fungi, DNA extraction, running gel electrophoresis, analysis of sequence and construction of phylogenetic tree, data analysis, and drafting manuscript. R. C. Cheruiyot participated in the creation of the concept of the manuscript, revision of the manuscript, and approval of the manuscript. J. Mbaka was responsible for confirmation of the identity of fungi morphologically, methodical consultation in revision of the manuscript, and approval of manuscript. A. Alakonya was responsible for revision of the manuscript mainly regarding molecular section and approval of manuscript. E. Monda participated in the conception and design of the experiment, identification of fungi morphologically, sequence analysis, and methodical consultation in verification and approval of the manuscript.

Acknowledgments

The authors acknowledge Kenyatta University for granting study leave, Kenya Agricultural Research and Livestock Organisation (KARLO), Kandara and Kenya Plant Health Inspectorate Services (KEPHIS) where morphological and molecular studies were conducted, respectively, and Inqaba Biotec, South Africa, for DNA sequencing.

References

  1. A. T. Djami-Tchatchou, C. J. Straker, and F. Allie, “454 Sequencing for the identification of genes differentially expressed in avocado fruit (cv. Fuerte) infected by Colletotrichum gloeosporioides,” Journal of Phytopathology, vol. 160, no. 9, pp. 449–460, 2012. View at Publisher · View at Google Scholar · View at Scopus
  2. J. E. Erpelding, “Field assessment of anthracnose disease response for the Sorghum germplasm collection from the Mopti region,” American Journal of Agricultural and Biological Sciences, vol. 5, no. 3, pp. 363–369, 2010. View at Publisher · View at Google Scholar · View at Scopus
  3. C. A. Onyeani and N. A. Amusa, “Incidence and severity of anthracnose in mango fruits and its control with plant extracts in south west nigeria,” International Journal of Agricultural Research, vol. 10, no. 1, pp. 33–43, 2015. View at Publisher · View at Google Scholar · View at Scopus
  4. M. Sharma and S. Kulshrestha, “Colletotrichum gloeosporioides: an anthracnose causing pathogen of fruits and vegetables,” Biosciences, Biotechnology Research Asia, vol. 12, no. 2, pp. 1233–1246, 2015. View at Publisher · View at Google Scholar · View at Scopus
  5. H. V. Silva-Rojas and G. D. Ávila-Quezada, “Phylogenetic and morphological identification of Colletotrichum boninense: a novel causal agent of anthracnose in avocado,” Plant Pathology, vol. 60, no. 5, pp. 899–908, 2011. View at Publisher · View at Google Scholar · View at Scopus
  6. A. Valencia, R. Torres, and B. Latorre, “First report of Pestalotiopsis clavispora and Pestalotiopsis spp. causing postharvest stem end rot of avocado in Chile,” Plant Disease, vol. 95, no. 4, pp. 492-493, 2011. View at Google Scholar
  7. H. J. Boesewinkel, “A list of 142 new plant disease recordings from New Zealand and short notes on three diseases,” Australasian Plant Pathology, vol. 11, no. 4, pp. 40–43, 1982. View at Publisher · View at Google Scholar · View at Scopus
  8. F. Liu, M. Wang, U. Damm, P. W. Crous, and L. Cai, “Species boundaries in plant pathogenic fungi: a Colletotrichum case study,” BMC Evolutionary Biology, vol. 16, no. 1, article 649, 2016. View at Publisher · View at Google Scholar · View at Scopus
  9. N. A. R. Peres, E. E. Kuramae, M. S. C. Dias, and N. L. De Souza, “Identification and characterization of Colletotrichum spp. affecting fruit after harvest in Brazil,” Journal of Phytopathology, vol. 150, no. 3, pp. 128–134, 2002. View at Publisher · View at Google Scholar · View at Scopus
  10. D. G. Rodriguez-Sanchez, M. Flores-García, C. Silva-Platas et al., “Isolation and chemical identification of lipid derivatives from avocado (Persea americana) pulp with antiplatelet and antithrombotic activities,” Food & Function, vol. 6, no. 1, pp. 193–203, 2015. View at Publisher · View at Google Scholar · View at Scopus
  11. M. V. Valle and A. Campos-Martínez, “First report of avocado anthracnose caused by Colletotrichum karstii in Mexico,” Plant Disease, vol. 100, no. 2, p. 534, 2016. View at Google Scholar
  12. S. L. Willingham, A. W. Cooke, L. M. Coates, and K. G. Pegg, “Pepper spot: a new preharvest Colletotrichum disease of avocado cv. Hass,” Australasian Plant Pathology, vol. 29, no. 2, p. 151, 2000. View at Google Scholar
  13. D. F. Farr, M. C. Aime, A. Y. Rossman, and M. E. Palm, “Species of colletotrichum on agavaceae,” Mycological Research, vol. 110, no. 12, pp. 1395–1408, 2006. View at Publisher · View at Google Scholar · View at Scopus
  14. B. Schaffer, B. Wolstenholme, and A. Whiley, The Avocado: Botany, Production and Uses, CABI, 2013.
  15. G. N. Agrios, Plant Pathology, Elsevier Academic Press, 2005.
  16. E. Dann, R. Ploetz, L. Coates, and K. Pegg, “Foliar, fruit and soilborne diseases,” in The Avocado: Botany, Production and Uses, pp. 380–422, 2013. View at Google Scholar
  17. A. Gautam, “Colletotrichum gloeosporioides: biology, pathogenicity and management in India,” Plant Physiology & Pathology, vol. 2, no. 2, article 2, 2014. View at Google Scholar
  18. K. Pernezny and R. Marlatt, “Diseases of avocado in Florida,” Plant Pathol Fact Sheet 21, 2000. View at Google Scholar
  19. L. Wasilwa, J. Njuguna, and E. Okoko, Status of Avocado Production in Kenya, Kenya Agricultural Research Institute, Nairobi, Kenya, 2004.
  20. Y. Choi, K. Hyde, and W. Ho, Fungal Diversity, Fungal Diversity Press, 1999.
  21. S. Freeman, T. Katan, and E. Shabi, “Characterization of Colletotrichum species responsible for anthracnose diseases of various fruits,” Plant Disease, vol. 82, no. 6, pp. 596–605, 1998. View at Publisher · View at Google Scholar · View at Scopus
  22. A. Nagamani and I. K. Kunwar, Handbook of Soil Fungi, Edited by K. Indra and C. Manoharachary, I.K. International, 2009.
  23. B. Liu, F. J. Louws, T. B. Sutton, and J. C. Correll, “A rapid qualitative molecular method for the identification of Colletotrichum acutatum and C. gloeosporioides,” European Journal of Plant Pathology, vol. 132, no. 4, pp. 593–607, 2012. View at Publisher · View at Google Scholar · View at Scopus
  24. S. Kumar, G. Stecher, and K. Tamura, “MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets,” Molecular Biology and Evolution, vol. 33, no. 7, pp. 1870–1874, 2016. View at Publisher · View at Google Scholar
  25. K. Takahashi and M. Nei, “Efficiencies of fast algorithms of phylogenetic inference under the criteria of maximum parsimony, minimum evolution, and maximum likelihood when a large number of sequences are used,” Molecular Biology and Evolution, vol. 17, no. 8, pp. 1251–1258, 2000. View at Publisher · View at Google Scholar · View at Scopus
  26. H. Kishino and M. Hasegawa, “Evaluation of the maximum likelihood estimate of the evolutionary tree topologies from DNA sequence data, and the branching order in hominoidea,” Journal of Molecular Evolution, vol. 29, no. 2, pp. 170–179, 1989. View at Publisher · View at Google Scholar · View at Scopus
  27. K. Domsch, W. Gams, and T. Anderson, Compendium of Soil Fungi, vol. 1, Academic Press, 1980.
  28. A. J. Rabha, A. Naglot, G. D. Sharma et al., “Morphological and molecular diversity of endophytic Colletotrichum gloeosporioides from tea plant, Camellia sinensis (L.) O. Kuntze of Assam, India,” Journal of Genetic Engineering and Biotechnology, vol. 14, no. 1, pp. 181–187, 2016. View at Publisher · View at Google Scholar · View at Scopus
  29. C. F. B. Silva and S. J. Michereff, “Biology of Colletotrichum spp. and epidemiology of the anthracnose in tropical fruit trees,” Revista Caatinga, vol. 26, no. 4, pp. 130–138, 2014. View at Google Scholar
  30. K. D. Hyde, R. H. Nilsson, S. A. Alias et al., “One stop shop: backbones trees for important phytopathogenic genera: I (2014),” Fungal Diversity, vol. 67, no. 1, pp. 21–125, 2014. View at Publisher · View at Google Scholar · View at Scopus
  31. M. Zakaria and J. A. Bailey, “Morphology and cultural variation among Colletotrichum isolates obtained from tropical forest nurseries,” Journal of Tropical Forest Science, vol. 12, no. 1, pp. 1–20, 2000. View at Google Scholar · View at Scopus
  32. P. Chowdappa, C. S. Chethana, R. Bharghavi, H. Sandhya, and R. P. Pant, “Morphological and molecular characterization of Colletotrichum gloeosporioides (Penz) Sac. isolates causing anthracnose of orchids in India,” Biotechnology, Bioinformatics and Bioengineering, vol. 2, no. 1, pp. 567–572, 2012. View at Google Scholar
  33. E. El-Argawy, “haracterization and control of Pestalotiopsis spp. the causal fungus of guava scabby canker in el-beheira governorate, Egypt,” International Journal of Phytopathology, vol. 4, no. 3, pp. 121–136, 2016. View at Google Scholar
  34. A. Vidyalakshmi and C. V. Divya, “New report of Colletotrichum gloeosporioides causing anthracnose of Pisonia alba in India,” Archives of Phytopathology and Plant Protection, vol. 46, no. 2, pp. 201–204, 2013. View at Publisher · View at Google Scholar · View at Scopus
  35. W. V. Parker, P. R. Johnston, and U. Damm, “Colletotrichum gloeosporioides species complex,” Studies in Mycology, vol. 73, pp. 115–180, 2012. View at Google Scholar
  36. J. O. Honger, S. K. Offei, K. A. Oduro, G. T. Odamtten, and S. T. Nyaku, “Identification and molecular characterisation of Colletotrichum species from avocado, citrus and pawpaw in Ghana,” South African Journal of Plant and Soil, vol. 33, no. 3, pp. 177–185, 2016. View at Publisher · View at Google Scholar · View at Scopus
  37. Y. Siddiqui and A. Ali, “Chapter 11—Colletotrichum gloeosporioides (Anthracnose),” in Postharvest Decay, 2014. View at Google Scholar
  38. M. Twizeyimana, H. Förster, V. McDonald, D. H. Wang, J. E. Adaskaveg, and A. Eskalen, “Identification and pathogenicity of fungal pathogens associated with stem-end rot of avocado in California,” Plant Disease, vol. 97, no. 12, pp. 1580–1584, 2013. View at Publisher · View at Google Scholar · View at Scopus
  39. R. Dean, J. A. L. Van Kan, Z. A. Pretorius et al., “The Top 10 fungal pathogens in molecular plant pathology,” Molecular Plant Pathology, vol. 13, no. 4, pp. 414–430, 2012. View at Publisher · View at Google Scholar · View at Scopus
  40. F. R. Giblin, L. M. Coates, and J. A. G. Irwin, “Pathogenic diversity of avocado and mango isolates of Colletotrichum gloeosporioides causing anthracnose and pepper spot in Australia,” Australasian Plant Pathology, vol. 39, no. 1, pp. 50–62, 2010. View at Publisher · View at Google Scholar · View at Scopus
  41. A. Hernandez-Lauzardo and A. Campos-Martínez, “First report of Colletotrichum godetiae causing anthracnose on avocado in Mexico,” Plant Disease, vol. 99, no. 10, p. 555, 2015. View at Google Scholar
  42. G. Ding, Z. Zheng, S. Liu, H. Zhang, L. Guo, and Y. Che, “Photinides A–F, cytotoxic benzofuranone-derived γ-lactones from the plant endophytic fungus Pestalotiopsis photiniae,” Journal of Natural Products, vol. 72, no. 5, pp. 942–945, 2009. View at Publisher · View at Google Scholar · View at Scopus
  43. L. Liu, S. Liu, X. Chen, L. Guo, and Y. Che, “Pestalofones A–E, bioactive cyclohexanone derivatives from the plant endophytic fungus Pestalotiopsis fici,” Bioorganic & Medicinal Chemistry, vol. 17, no. 2, pp. 606–613, 2009. View at Publisher · View at Google Scholar · View at Scopus
  44. Y. Suto and T. Kobayashi, “Taxonomic studies on the species of Pestalotiopsis, parasitic on conifers in Japan,” Transactions of the Mycological Society of Japan, 1993. View at Google Scholar
  45. A. M. Ismail, G. Cirvilleri, and G. Polizzi, “Characterisation and pathogenicity of Pestalotiopsis uvicola and Pestalotiopsis clavispora causing grey leaf spot of mango (Mangifera indica L.) in Italy,” European Journal of Plant Pathology, vol. 135, no. 4, pp. 619–625, 2013. View at Publisher · View at Google Scholar · View at Scopus
  46. J. Darvas, “Fungi associated with pre-and postharvest diseases of avocado fruit at Westfalia Estate, South Africa,” Phytophylactica, vol. 19, no. 1, pp. 83–86, 1987. View at Google Scholar
  47. M. Kamhawy, M. Hassan, and S. Sharkawy, “Morphological and phylogenetic characterization of pestalotiopsis in relation to host association,” Egyptian Journal of Agricultural Research, vol. 89, no. 1, pp. 1–16, 2011. View at Google Scholar
  48. L. M. Keith, M. E. Velasquez, and F. T. Zee, “Identification and characterization of Pestalotiopsis spp. causing scab disease of guava, Psidium guajava, in Hawaii,” Plant Disease, vol. 90, no. 1, pp. 16–23, 2006. View at Publisher · View at Google Scholar · View at Scopus
  49. A. M. Metz, A. Haddad, J. Worapong et al., “Induction of the sexual stage of Pestalotiopsis microspora, a taxol-producing fungus,” Microbiology, vol. 146, no. 8, pp. 2079–2089, 2000. View at Publisher · View at Google Scholar · View at Scopus