Research Article
Prevalence of Helicobacter pylori cagA and iceA Genes and Their Association with Gastrointestinal Diseases
Table 1
Primer sequences used in this study.
| Gene | Primer sequence | Size (bp) |
| UreC (glmM) | Forward: 5′- AA GCTTTTAGGGTGTTAGGGGTTT -3′ | 294 | Reverse: 5′- AAGCTTACTTTCTAACACTAACGC -3′ |
| cagA | Forward: 5′- AATACACCAACGCCTCCAAG -3′ | 400 | Reverse: 5′- TTGTTGGCGCTTGCTCTC -3′ |
| iceA1 | Forward: 5′- CGTTGGGTAAGCGTTACAGAATTT -3′ | 558 | Reverse: 5′- TCATTGTATATCCTATCATTACAAG -3′ |
| iceA2 | Forward: 5′- GTTGTCGTTGTTTTAATGAA -3′ | 120 | Reverse: 5′- GTCTTAAACCCCACGATTAAA -3′ |
|
|