International Journal of Polymer Science

International Journal of Polymer Science / 2017 / Article

Corrigendum | Open Access

Volume 2017 |Article ID 2840249 |

Mark Luigi Fabian Capati, Ayako Nakazono, Kohei Yamamoto, Kouji Sugimoto, Kajiro Yanagiguchi, Shizuka Yamada, Yoshihiko Hayashi, "Corrigendum to “Fish Collagen Promotes the Expression of Genes Related to Osteoblastic Activity”", International Journal of Polymer Science, vol. 2017, Article ID 2840249, 2 pages, 2017.

Corrigendum to “Fish Collagen Promotes the Expression of Genes Related to Osteoblastic Activity”

Received26 Oct 2017
Accepted29 Oct 2017
Published22 Nov 2017

In the article titled “Fish Collagen Promotes the Expression of Genes Related to Osteoblastic Activity” [1], there were errors, which should be corrected as follows:(i)The term “TCA” should be corrected to “TAC” throughout the article.(ii)In the sixth row of Table , “Chordin-like 1 (Chrd1)” should be corrected to “Chordin-like 1 (Chrdl1).” The corrected table is shown below.(iii)In Figure , “Pgfr” should be corrected to “Fgfr3,” and “Chrdl” should be corrected to “Chrdl1.” The corrected figure is shown below.(iv)In the Discussion, “In the present experiment, the function of MC3T3-E1 cells was accelerated after three-day culture in FC-positive or BGP-positive group, which was confirmed by the increase of the expression of calcification-related genes, except OCN,” should be corrected to “In the present experiment, the function of MC3T3-E1 cells was accelerated after three-day culture in FC-positive or BGP-positive group, which was confirmed by the increase of the expression of calcification-related genes, except OPN.”

Gene nameOligonucleotides

Matrix metallopeptidase 13 (Mmp13)Forward: AGGCCTTCAGAAAAGCCTTC
Wnt inhibitory factor 1 (Wif1)Forward: GAGTGTCCGGATGGGTTCTA

Receptor activity modifying protein 1 (Ramp1)Forward: GCGGTATCCTCCTGAAAACA

SMAD family member 6 (Smad6)Forward: ACGGTGACCTGCTGTCTCTT
Platelet-derived growth factor, D polypeptide (Pdgfd)Forward: TCAGCTGTGTGCTCAACAAA

Chordin-like 1 (Chrdl1)Forward: TGGTCTTTGCTTTCCCATGT
Fibroblast growth factor receptor 3 (Fgfr3)Forward: ACAAGGACCGTACTGCCAAG
Vitamin D receptor (Vdr)Forward: CGGAAATGGGTACCAAAATG
Ribosomal protein S17 (rpS17)Forward: GCATATCATGCAACGCTTTC


  1. M. L. F. Capati, A. Nakazono, K. Yamamoto et al., “Fish collagen promotes the expression of genes related to osteoblastic activity,” International Journal of Polymer Science, vol. 2016, Article ID 5785819, 7 pages, 2016. View at: Publisher Site | Google Scholar

Copyright © 2017 Mark Luigi Fabian Capati et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

More related articles

 PDF Download Citation Citation
 Download other formatsMore
 Order printed copiesOrder

Related articles

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.