International Scholarly Research Notices / 2012 / Article / Tab 2

Research Article

CallSim: Evaluation of Base Calls Using Sequencing Simulation

Table 2

Subset of original and adjusted reads.

Test CaseSequences

(1) Ion Torrent371718.fig.0011
CGTTTACGTGAAAGGATTGAAGATG_ATCCGT_C_ACA
(2) 454371718.fig.0012
TGGCGCTCATGGCGACCTTTAAGATACAACCAGTGTTT

These are the reads from the two test cases in the regions of interest, and the bold green bases are the ones corresponding to the green signal of interest.