International Scholarly Research Notices / 2012 / Article / Tab 1

Research Article

miR-320 Regulates Glucose-Induced Gene Expression in Diabetes

Table 1

Oligonucleotide sequences for RT-PCR.

GeneSequence (5 → 3)

ET-15AAGCCCTCCAGAGAGCGTTAT3
5CGAAGGTCTGTCACCAATGT3
6FAM-TGACCCACAACCGAG-GBNFQ

FN-15GATAAATCAACAGTGGGAGC3
5CCCAGATCATGGAGTCTTTA3

VEGF5TCCTCACACCATTGAAACCA3
5GATCCTGCCCTGTCTCTCTG3

β-actin 5CATCGTACTCCTGCTTGCTG3
5CCTCTATGCCAACACAGTGC3

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.