International Scholarly Research Notices / 2013 / Article / Tab 2

Research Article

Analysis of CYP2D6 Allele Frequencies and Identification of Novel SNPs and Sequence Variations in Sardinians

Table 2

List of primers used in CYP2D6 Long PCR protocols. P–1780 was designed in a highly non-homologous CYP2D6/CYP2D7P/CYP2D8P 5′untranslated region (nucleotides –1780_–1758 according to AY545216 sequence [13]). P–1584_WT and P–1584_MUT are modification of primer –1584G>C (Table 3) by addiction of a 3′-dNTP complementary to wild-type (WT) nucleotide or SNP (MUT), to create an amplification allele-specific. The 5′ 10-mer tag was added to PCR primers, in order to improve PCR efficiency.

Nucleotides positionName5′ 10-mer tag5′-sequence-3′Direction

From −1780 to −1758P–1780ACGTTGGATGGTCCTCCTGTCCTCAGTGGATForward
From −1584 to −1559P–1584_WTACGTTGGATGCAGCCTGGACAACTTGGAAGAAGCCForward
From −1584 to −1559P–1584_MUTACGTTGGATGCAGCCTGGACAACTTGGAAGAAGCGForward
From 4706 to 47282D6–R [14]ACGTTGGATGACTGAGCCCTGGGAGGTAGGTAReverse

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.