International Scholarly Research Notices

International Scholarly Research Notices / 2013 / Article

Research Article | Open Access

Volume 2013 |Article ID 286182 | https://doi.org/10.1155/2013/286182

Seong Yoon Kim, Seong Hwan Park, Huguo Piao, Ukhee Chung, Kwang Soo Ko, Juck-Joon Hwang, "Vouchering of Forensically Important Fly Specimens by Nondestructive DNA Extraction", International Scholarly Research Notices, vol. 2013, Article ID 286182, 5 pages, 2013. https://doi.org/10.1155/2013/286182

Vouchering of Forensically Important Fly Specimens by Nondestructive DNA Extraction

Academic Editor: J. D. Andrade Filho
Received12 Nov 2012
Accepted28 Nov 2012
Published19 Dec 2012

Abstract

DNA extraction frequently requires destruction of whole samples. However, when the sample is very rare or has taxonomic importance, nondestructive DNA extraction is required for preservation of voucher specimens. In the case of arthropod specimens, minor anatomical structures such as a single leg or a single wing are often sacrificed instead of the whole body for DNA extraction. In an attempt to save the entire anatomical structure of specimens, several authors tried to brew the whole specimen in a lysis buffer and to extract DNA from the “soup.” We applied this nondestructive DNA extraction technique to a forensically important blowfly species, Phaenicia sericata. With nondestructive DNA extraction, a satisfactory quantity and quality of DNA for PCR amplification was obtained with only minimal anatomical disruptions that do not alter the morphologic identification. This nondestructive method may be applicable to DNA extraction of rare samples as well as vouchering of regular fly samples.

1. Introduction

Most DNA extraction methods inevitably consume at least a small portion of biological specimens. Of course, minor damages to samples do not matter in many instances and many small insect samples are even totally grinded for DNA extraction [14]. However, because photographic records prior to sample destruction do not always preserve all the important morphologic features, saving voucher specimens is advisable for specimens with taxonomic importance. In the case of forensically important fly species, many authors have utilized small portions of the body such as legs, wings, thoracic muscle, and entire thorax [59]. However, preserving the entirety of the specimen is often preferred, and dissection of specific anatomical parts such as the thoracic muscle is often complex and time consuming. In 1995, Phillips and Simon tried to extract DNA from unimpaired arthropod specimens in the museum collection. However, Phillips and Simon made multiple punctures to the exoskeletons prior to the extraction and did not describe the detailed morphological disruptions after the extraction [10]. The idea to brew whole unimpaired samples in a lysis buffer and to extract DNA from the “soup” has emerged in the field of zoology. Rohland et al. extracted DNA from mammalian teeth without any destruction of the specimen by incubating the whole specimen in a digestion buffer [11]. Gilbert et al. and Rowley et al. applied Rohland’s method to beetles and various insect specimens and tested not only the DNA yields and qualities but also degrees of damages to the exoskeletons [12, 13]. Although Rowley et al. included a fly species Delphinia picta in their study, it is taxonomically distant from most forensically important fly species [13]. To our knowledge, there has been no study which applied the nondestructive DNA extraction technique to forensically important fly species. We tested a nondestructive DNA extraction method for artificially reared Phaenicia sericata (P. sericata) specimens and compared key morphological features before and after DNA extraction.

2. Materials and Methods

2.1. Fly Specimens

Five artificially reared individuals of P. sericata were collected from the cage. Collected flies were anesthetized with ethylacetate and then submerged in 70% ethyl alcohol solution. After overnight treatment at −20°C, submerged specimens were picked out and air-dried at room temperature. Dried specimens were observed and recorded as digital images under a dissecting microscope.

2.2. DNA Extraction

Fly specimens were totally submerged in 400 μL volume of lysis buffer solution (100 mM NaCl, 10 mM Tris, 5 mM EDTA, 2% SDS, and 0.2 mg/mL proteinase K) and incubated for 4 hours at 55°C without shaking. Although overnight incubation may guarantee a better DNA yield, as it did for Gilbert et al. [12], we adopted the incubation time from Rowley et al. [13], who included thin-cuticled taxa for their experiments. After incubation, fly samples were submerged in 100% ethyl alcohol for further storage. The incubated lysis buffer was processed by classic phenol/chloroform DNA extraction method [14]. Precipitated DNA was eluted in a 40 μL volume of double-distilled H2O. DNA concentration was measured by ultraviolet absorbance at 260 nm.

2.3. Postextraction Photographs

After DNA extraction, fly specimens were removed from 100% ethyl alcohol and dried at room temperature. Postextraction photographs were taken in the same manner as the preextraction photographs.

2.4. Polymerase Chain Reaction (PCR)

Primer pairs for cytochrome c oxidase subunit I (COI) gene and ribosomal internal transcribed spacer 2 (ITS2) were chosen for assessment of PCR amplificability from mitochondrial and nuclear DNA, respectively. Primer sequences and PCR amplicon sizes are listed in Table 1. For each 10 μL reaction volume, 20 ng of fly DNA, 25 nmole of MgCl2, 2 pmole of each dNTP, 2 × 10−6 pmole of each primer, 0.2 U of Amplitaq Gold DNA polymerase (Applied Biosystems, Foster City, CA), and 1.0 μL of 10x PCR buffer were used. After 1 cycle at 95°C for 11 min of hot start enzyme activation, fly DNAs were amplified by 35 cycles at 95°C for 30 sec, 55°C for 30 sec, 72°C for 90 sec, and 72°C for 15 min of final extension with GeneAmp 2720 or 9600 PCR Systems (Applied Biosystems, Foster City, CA). However, for the primer pair COI-F(tRNA Cystein) and COI-R(COII), PCR cycles and extension time were increased to 40 and 120 sec, respectively. Amplified DNA fragments were visualized with electrophoreses in 3% agarose gels, which consist of 2% Nusieve and 1% Seakem (Cambrex, Charles City, IA).


Primer namesPrimer sequencesPCR product sizes

COI-F(tRNA cystein)CCTTTAGAATTGCAGTCTAATGTCA1738 bp
COI-R(COII)CCTAAATTTGCTCATGTTGACA
COI-F(1001~22)CTGCTACTTTATGAGCTTTAGG629 bp with COI-R(COII)
ITS2-FGAACTGCAGGACACATGAAC492 bp
ITS2-RCCTCCCCTCATTAATATGCT

3. Results

3.1. DNA Yields

DNA concentrations and yields are summarized in Table 2. The yield of sample number 5 is about eleven times larger than that of sample number 3. Even with minimal yield (1.38 μg), a PCR amplification using 50 ng of DNA template can be performed twenty-seven times. If each PCR covers a 500-base pair DNA fragment, twenty-seven PCRs can cover 13,500 base pairs of DNA sequence. With the average yield (5.65 μg), the same PCR amplification can be performed up to 113 times. Therefore, the amount of DNA extracted with the nondestructive DNA extraction was sufficient for full coverage of most molecular markers for species identification, such as COI and ITS2.


Sample numberDNA concentration (ng/ )260/280 ratioYield ( g)

178.61.533.14
241.71.711.67
334.51.871.38
4167.41.786.70
5384.61.5515.38

Average141.41.695.65

3.2. PCR Amplification

All five samples displayed visible DNA bands for all three primer pairs (Figure 1). However, band intensities were weak for the primer pair COI-F(tRNA Cystein) and COI-R(COII), for which the amplicon size is 1738 base pairs including the whole mitochondrial COI gene. In the cases of shorter amplicons, both mitochondrial (629 base pairs) and nuclear (492 base pairs) markers were excellently amplified.

3.3. Disruption of Key Features for Morphological Identification after DNA Extraction

The overall morphologic features were excellently preserved after DNA extraction in all samples. Generally, the metallic green gloss which is typical for Luciliinae fly species became slightly dull (Figure 2). A few slight disruptions to particular morphologic features were observed. Although even small bristles were not disrupted, one of the two mid legs was lost in two samples during DNA extraction (Figure 3). Despite shrinkage to the membranous part and a few disruptions of veins, the general integrity of the wings remained intact and suitable for identification of venous branching patterns (Figure 4). Disruptions in morphological features after DNA extraction are summarized in Table 3.


Anatomical regionsImportant characteristicsNumber of flies
No changesMinor disruption

Head
 Occipital setae3 to 8 pairs of bristles50
 Segments of antennae50
 Aristalong plumose50
 Palpus50

Thorax
 Acrostichal bristles2 + 3 pairs of bristles50
 Dorsocentral bristles3 + 3 pairs of bristles50
 Notopleural bristles2 bristles50
 Postalar declivity6 to 8 pairs
of fine hairs
50
 Propleuronnumerous hairs50
 Suprasquamal ridgenumerous black hairs50
 Hypopleural bristles50
 Basicostaorange color50
 Integrity of wingspattern of veins05
 Forelegs1 pair50
 Mid legs1 pair32
 Hind legs1 pair50

4. Discussion

The numbers of nucleotide sequences of forensically important fly species in NCBI Genbank are rapidly increasing. However, sequence acceptance in NCBI Genbank does not guarantee the accuracy of species identification of the specimen. In the field of forensic entomology, several sequences of Calliphoridae fly species, which are quite different from other conspecific sequences or identical to heterospecific sequences, hamper accurate species identification using DNA sequences [15, 16]. Therefore, in those cases, it is ideal for sequence submitters to share their voucher specimens for reconfirmation of morphological identification keys. According to our results using nondestructive DNA extraction, all of the five samples did not show any significant morphologic disruption which may affect species identification. Moreover, nondestructive DNA extraction provides a satisfactory quantity and quality of DNA for PCR amplification. This nondestructive method may be applicable to DNA extraction of rare samples as well as vouchering of regular fly samples. Although we applied traditional phenol/chloroform technique in this study, the incubated “soup” may be transferred to commercially available DNA extraction kits using spin columns.

References

  1. M. D. Dean and J. W. O. Ballard, “Factors affecting mitochondrial DNA quality from museum preserved drosophila simulans,” Entomologia Experimentalis et Applicata, vol. 98, no. 3, pp. 279–283, 2001. View at: Publisher Site | Google Scholar
  2. S. H. Park, Y. Zhang, H. Piao et al., “Sequences of the Cytochrome C Oxidase Subunit I (COI) gene are suitable for species identification of Korean calliphorinae flies of forensic importance (Diptera: Calliphoridae),” Journal of Forensic Sciences, vol. 54, no. 5, pp. 1131–1134, 2009. View at: Publisher Site | Google Scholar
  3. K. Saigusa, M. Takamiya, and Y. Aoki, “Species identification of the forensically important flies in Iwate prefecture, Japan based on mitochondrial cytochrome oxidase gene subunit I (COI) sequences,” Legal Medicine, vol. 7, no. 3, pp. 175–178, 2005. View at: Publisher Site | Google Scholar
  4. S. Vincent, J. M. Vian, and M. P. Carlotti, “Partial sequencing of the cytochrome oxydase b subunit gene I: a tool for the identification of European species of blow flies for postmortem interval estimation,” Journal of Forensic Sciences, vol. 45, no. 4, pp. 820–823, 2000. View at: Google Scholar
  5. M. L. Harvey, M. W. Mansell, M. H. Villet, and I. R. Dadour, “Molecular identification of some forensically important blowflies of southern Africa and Australia,” Medical and Veterinary Entomology, vol. 17, no. 4, pp. 363–369, 2003. View at: Publisher Site | Google Scholar
  6. A. C. M. Junqueira, A. C. Lessinger, and A. M. L. Azeredo-Espin, “Methods for the recovery of mitochondrial DNA sequences from museum specimens of myiasis-causing flies,” Medical and Veterinary Entomology, vol. 16, no. 1, pp. 39–45, 2002. View at: Publisher Site | Google Scholar
  7. Q. L. Liu, J. F. Cai, Y. F. Chang et al., “Identification of forensically important blow fly species (Diptera: Calliphoridae) in China by mitochondrial cytochrome oxidase I gene differentiation,” Insect Science, vol. 18, pp. 554–564, 2011. View at: Google Scholar
  8. J. Stevens and R. Wall, “Genetic variation in populations of the blowflies Lucilia cuprina and lucilia sericata (Diptera: Calliphoridae). Random amplified polymorphic DNA analysis and mitochondrial DNA sequences,” Biochemical Systematics and Ecology, vol. 25, no. 2, pp. 81–97, 1997. View at: Publisher Site | Google Scholar
  9. J. D. Wells and F. A. H. Sperling, “Molecular phylogeny of Chrysomya albiceps and C. rufifacies (Diptera: Calliphoridae),” Journal of Medical Entomology, vol. 36, no. 3, pp. 222–226, 1999. View at: Google Scholar
  10. A. J. Phillips and C. Simon, “Simple, efficient, and nondestructive DNA extraction protocol for arthropods,” Annals of the Entomological Society of America, vol. 88, no. 3, pp. 281–283, 1995. View at: Google Scholar
  11. N. Rohland, H. Siedel, and M. Hofreiter, “Nondestructive DNA extraction method for mitochondrial DNA analyses of museum specimens,” BioTechniques, vol. 36, no. 5, pp. 814–821, 2004. View at: Google Scholar
  12. M. T. P. Gilbert, W. Moore, L. Melchior, and M. Worebey, “DNA extraction from dry museum beetles without conferring external morphological damage,” PLoS ONE, vol. 2, no. 3, article e272, 2007. View at: Publisher Site | Google Scholar
  13. D. L. Rowley, J. A. Coddington, M. W. Gates et al., “Vouchering DNA-barcoded specimens: test of a nondestructive extraction protocol for terrestrial arthropods,” Molecular Ecology Notes, vol. 7, no. 6, pp. 915–924, 2007. View at: Publisher Site | Google Scholar
  14. J. Butler, M.Forensic DNA Typing: Biology, Technology, and Genetics of STR Markers, Elsevier Academic Press, Burlington, Mass, USA, 2005.
  15. S. H. Park, Y. Zhang, H. Piao et al., “Use of Cytochrome C Oxidase Subunit I (COI) nucleotide sequences for identification of the Korean Luciliinae Fly species (Diptera: Calliphoridae) in forensic investigations,” Journal of Korean Medical Science, vol. 24, no. 6, pp. 1058–1063, 2009. View at: Publisher Site | Google Scholar
  16. J. D. Wells, R. Wall, and J. R. Stevens, “Phylogenetic analysis of forensically important Lucilia flies based on cytochrome oxidase I sequence: a cautionary tale for forensic species determination,” International Journal of Legal Medicine, vol. 121, no. 3, pp. 229–233, 2007. View at: Publisher Site | Google Scholar

Copyright © 2013 Seong Yoon Kim et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


More related articles

 PDF Download Citation Citation
 Download other formatsMore
 Order printed copiesOrder
Views1591
Downloads661
Citations

Related articles

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.