International Scholarly Research Notices / 2013 / Article / Tab 1

Research Article

Differentiation of Human Dermal Mesenchymal Stem Cells into Cardiomyocytes by Treatment with 5-Azacytidine: Concept for Regenerative Therapy in Myocardial Infarction

Table 1

Primer sequence for cardiac specific genes.

GeneSequenceBase pair

α-cardiac actinF: 5′TCTATGAGGGCTACGCTTTG3′259
R: 5′GCCAATAGTGATGACTTGGC3′
Cardiac troponin TF: 5′AGAGCGGAAAAGTGGGAAGA3′234
R: 5′CTGGTTATCGTTGATCCTGT3′
β-myosin heavy chainF: 5′CGAGGCAAGCTCACCTACAC3′318
R: 5′CATTAACAGCCTCCACGGCC3′