International Scholarly Research Notices / 2013 / Article / Tab 3

Research Article

Examination of the Anti-Inflammatory, Antioxidant, and Xenobiotic-Inducing Potential of Broccoli Extract and Various Essential Oils during a Mild DSS-Induced Colitis in Rats

Table 3

Gene bank accession numbers and primer sequences of the genes investigated by real-time RT-PCR.

Gene name (abbreviation used)Gene bank accession numberPrimer sequences ( )
for = forward; rev = reverse;

Chemokine (C-C motif) ligand 2 (Ccl2) (MCP1)NM_031530for: GTGCGACCCCAATAAGGAA
rev: TGAGGTGGTTGTGGAAAAGA
Claudin 3 (Cldn3)NM_031700for: TATCCTACTGGCAGCCTTCG
rev: GTTCCCATCTCTCGCTTCTG
Copper/zinc superoxide dismutase (SOD1)NM_017050for: CCACTGCAGGACCTCATTTT
rev: CACCTTTGCCCAAGTCATCT
C-reactive protein (CRP)NM_017096for: GTCTCTATGCCCACGCTGAT
rev: CCGTCAAGCCAAAGCTCTAC
Glutathione S-transferase K1 (GSTK1)NM_181371for: GAGCATGGAGCAACCAGAGAT
rev: AGCTTGCTCTTCACCAGTTCG
Glutathione S-transferase P1 (GSTP1)NM_012577for: GAGGCAAAGCTTTCATTGTGG
rev: GTTGATGGGACGGTTCAAATG
Glutathione S-transferase T2 (GSTT2)NM_012796for: GAGGAAAAGGTGGAACGGAAC
rev: CGCCCCTCAAACAGATTACAG
Glutathione peroxidase 2 (GPx2)NM_183402for: GTGTGATGTCAATGGGCAGAA
rev: ACGTTTGATGTCAGGCTCGAT
Heme oxygenase 1 (HO1)NM_012580for: AGGCACTGCTGACAGAGGAAC
rev: AGCGGTGTCTGGGATGAACTA
Hypoxanthine phosphoribosyltransferase 1 (Hprt1)NM_012583for: GCAGACTTTGCTTTCCTTGG
rev: TCCACTTTCGCTGATGACAC
Interleukin 1 beta (IL-1β)NM_031512for: CTGTGACTCGTGGGATGATG
rev: GGGATTTTGTCGTTGCTTGT
Interleukin 10 (IL-10)NM_012854for: CTGGAGTGAAGACCAGCAAAGG
rev: GGAGAAATCGATGACAGCGTCG
Kelch-like ECH-associated protein1 (Keap1)NM_057152for: GTGGCGGATGATTACACCAAT
rev: GAAAAGTGTGGCCATCGTAGC
NAD(P)H dehydrogenase [quinone] 1 (NQO1)NM_017000for: CGCAGAGAGGACATCATTCA
rev: CGCCAGAGATGACTCAACAG
Nuclear factor (erythroid-derived 2)-like 2 (Nrf2)NM_031789for: CCAAGGAGCAATTCAACGAAG
rev: CTCTTGGGAACAAGGAACACG
Nuclear factor kappa B (NFκB)L26267for: CTTCTCGGAGTCCCTCACTG
rev: CCAATAGCAGCTGGAAAAGC
Prostaglandin-endoperoxide synthase 2 (Ptgs2) (COX2)NM_017232for: GCTGTACAAGCAGTGGCAAA
rev: CCCCAAAGACAGCATCTGGA
Ribosomal protein L13A (Rpl13a)NM_173340for: CCCTCCACCCTATGACAAGA
rev: CCTTTTCCTTCCGTTTCTCC
Tumor necrosis factor alpha (TNFα)NM_012675for: GCCAATGGCATGGATCTCAAAG
rev: AAATCGGCTGACGGTGTGGG
Vascular cell adhesion molecule 1 (VCAM 1)NM_012889for: TGACATCTCCCCTGGATCTC
rev: CTCCAGTTTCCTTCGCTGAC
β-actinNM_031144for: ATCGTGCGTGACATTAAAGAGAAG
rev: GGACAGTGAGGCCAGGATAGAG

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19.