Table 2: Gene name, GenBank accession numbers, primer sequences, annealing temperature ( ), amplicon length, and PCR efficiency for the studied genes.

GenesAccession numberPrimers 5′-3′ (forward, reverse) Amplicon size (bp)PCR efficiency (%)4

A2M 1CR452243CACCCAGGACACAGTGGTAGC
CCCTGAAGACTGGATGGTCAC
60°C10397.20

ACTB 1AY141970GCGTGGCTACAGCTTCACC
TTGATGTCACGGACGATTTC
60°C5690.70

B2M NM_173893CTGCTATGTGTATGGGTTCC
GGAGTGAACTCAGCGTG
60°C101131.37

EEF1A1 BC105315CATCCCAGGCTGACTGTGC
TGTAAGCCAAAAGGGCATGC
60°C101115.50

GAPDH 1BC102589TGGAAAGGCCATCACCATCT
CCCACTTGATGTTGGCAG
60°C6096.64

GTP 1AK074976CTTGGAATCCGAGGAGCCA
CCTGGGATCACCAGAGCTGT
60°C101102.91

HMBS 2BC112573.1CTTTGGAGAGGAATGAAGTGG
AATGGTGAAGCCAGGAGGAA
60°C80101.4

HPRTI 3BC103248GAGAAGTCCGAGTTGAGTTTGGAA
GGCTCGTAGTGCAAATGAAGAGT
64°C19099.70

RPL22 1BC114880AAGATGGCGCCGAAGAAAG
TTTCCCGAATCAAAAATTCCA
60°C101102.73

RPL4 NM_001014894 TTGGAAACATGTGTCGTGGG
GCAGATGGCGTATCGCTTCT
60°C10193.72

RPS15A BC108231 GAATGGTGCGCATGAATGTC
GACTTTGGAGCACGGCCTAA
60°C101119.08

RS18 DQ222453.1TTGCCTTTGCCATCACTG
CTTGTATTGGCGTGGATT
60°C158129.97

RPS23 1BC102049CCCAATGATGGTTGCTTGAA
CGGACTCCAGGAATGTCACC
60°C101115.5

RPS9 1DT860044CCTCGACCAAGAGCTGAAG
CCTCCAGACCTCACGTTTGTTC
60°C5496.45

UBC 2BE668033TCCCTACCTGCATCATGTGC
GGAATTTGGGCCAGTGCTC
59°C71104.71

UXT 1CR452243TGTGGCCCTTGGATATGGTT
GGTTGTCGCTGAGCTCTGTG
60°C10199.74

1Bionaz and Loor [19],2Pérez et al. [32], and 3Hernandez et al. [33].
4qPCR efficiencies for each primer pair were calculated from six-point standard curves using fivefold dilution series of pooled cDNA from control and heat-stressed samples.