International Scholarly Research Notices / 2013 / Article / Tab 2

Research Article

Activation of the NFκB Pathway Enhances AhR Expression in Intestinal Caco-2 Cells

Table 2

Sequences of primers used insite-directed mutagenesis experiments.

Sense primers (location)Sequence

AhRAP1-Mut1 (−626/−578) CTGCATTCACGAAAGTCATCAGCTACTACACATTGAGAAAACAAGAATG 3′
AhRAP1-Mut2 (−1125/−1077) GCTCCTCCAACTTTATGTACATTCAAATAACCTGGGAGTTCCTGTGAAC 3′
AhRAP1-Mut3 (−1526/−1477) GATTCTGCCTCTGCAATGGCTAAGGTATAAACATCAAACTTTCCCAGTG 3′
(−432/−382) CCCGCACACCAAAAAAGGTCAAGGTACCTCCTAGCCTTCAAGTCTCAACTC 3′
(−1115/−1066) CTTTATGTACATTTGAATCACCTGGTACCCCTGTGAACTTCGGGTTCTG 3′
(−1482/−1432) CAGTGTACACTGTCTTCTTTGGTACCTTGCTCCATCTTTTTCCTTAAACTG 3′

Binding site sequences are in bold, and mutated bases are underlined.

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19.