International Scholarly Research Notices / 2013 / Article / Tab 1

Research Article

Mutation Screening of Elongation Factor 2 in Shwachman-Diamond Syndrome Patients Lacking Mutations in the SBDS Gene

Table 1

Primers sequences and amplicon size of the 11 fragments used for the analysis of the EEF2 gene.

ExonForward primerReverse primerAmplicon length

1cctataaaaagctgagtgttgacgtccaccagcgaggcagggt142
2gtgccatgctgtgttcctggaaattcgctggactgaacctcactcatt425
3-4atgaatcttgggaccaagtcggtgctgtcacccaacattcctggcaaa872
5-6gtctactgaagaaagcctgcgtcttccagatcttaagagaggagccctga765
7tgggctttcttgtttcttggtgggtgtcagagcatccggaaacagca211
8-9tggcttcaagagaggaagcgtgtaatgctccttacttctagctcccga649
10tgaagaggatgtttcctgacagccagtctccatttacagccacagcca582
11ttcccagcaccttccctgaaatctcacatgcctgtggaagactgcaaa396
12aggatgcgtctgtgtgtaaggtcaatgaggtccctctagagcctggaa481
13-14acttggcaggtggagggcaatcaggacgcctcctttaacacctt563
15tgagctcctgacaggactttccttctgccctccctgcgaagacaccgtgaaa803

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.